UCSF Pharmacogenetics of Membrane Transporters
Assay View
Description:UCSF PMT DHPLC Method
Id:SLC6A2_11_DHPLC
Method Name:DHPLC Assay for exon11
Method Type:DHPLC
Mult Clones Tested:NA
Mult PCR Amplification Tested:Unknown
Name:DHPLC Assay for SLC6A2 DHPLC
Parameters:Method: The gene regions were PCR amplified from 50 ng genomic DNA and surveyed for polymorphisms using DHPLC and DNA sequencing. PCR 20uL total: 5 uL genomic DNA (10ng/uL) 2 uL primers (1-5 uM stock) 3uL water 10 uL AmpliTaq Gold MasterMix PCR Cleanup To above PCR reaction add: 2 U Exo1 (Exonuclease 1) 2 U SAP (shrimp alkaline phosphatase) Incubate: 60 min. at 37C followed by 15 min. at 95C 8 uL PCR product from each of 3 samples were pooled (samples were from different ethnic groups) to produce samples for DHPLC analysis. The pooled samples were heteroduplexed by denaturing at 95C for 8 min followed by annealing cycles from 94C-25C stepping down 0.5C for 19 sec each cycle. A 5uL volume of each heteroduplexed sample pool was analyzed using a HELIX DHPLC System (Varian Inc). The column temperature for analysis was estimated for each amplicon sequence using the Stanford DHPLC melt program [http://insertion.stanford.edu/melt.html], and the gradient conditions were estimated by amplicon size. The final analysis conditions were determined empirically by varying analysis conditions within the estimated temperature and gradient conditions on a standard control pool sample. The experimental sample pools were then analyzed at 2-4 selected temperatures, the elution profiles were scored by visual inspection, and the three samples in a pool with variant peaks were sequenced.
Template Type:Diploid
Type:dhplcAssay
poolSize:3
baselineSampleSize:6
Start OffsetStop OffsetDNA
interrogatedRange:1229None
NM_001043
NM_001172501
NM_001172504
NM_001172502

Transcript:NM_001043 [Chr.16(+): 55690352-55737700 GRCh37]
Position:Chr.16(+): 55733408-55733636 GRCh37
Chr.16(+): 54290909-54291137 NCBI36
Sequence:
GACCTGGCCCTGGCTATCATGGGGGCCATGGTAACAGGCCTGCCCTGTGTGTGCACAGGAGTGGACAGGTTCAGCAACGA
CATCCAGCAGATGATGGGGTTCAGGCCGGGTCTATACTGGAGACTGTGCTGGAAGTTCGTCAGTCCTGCCTTCCTCCTG
G
TGTGTAGTGTCTGCAGGGAAGTCCTGCATGTGGGGAGGGGGCTGTGTCCAGGATGGAGCTGGGTGAGGA
Color Legend: SNP  PRIMER  UTR  CODING
Interrogated: SNP  PRIMER  UTR  CODING

PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid Change
no variants