UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004790
NM_153276
NM_153277
NM_153278
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004790 [Chr.11(-): 62744069-62752495 GRCh37]
Id:SLC22A6_exon5
Position:Chr.11(-): 62748621-62748974 GRCh37
Chr.11(-): 62505197-62505550 NCBI36
Sequence:
TGGGTTCCCAACCTTAAATAAAATCCCATCGCAGACCCCTAGAAAGCCCAGCCCCAGCCCCCCACCCAGCTGACTGGAAC
TGAAGCCATGCTGACACCCACCCCCACCCCCGCTCCCAGGTTCTTCATTGAGTCGGCCCGCTGGCACTCCTCCTCCGGGA
GGCTGGACCTCAC
ACTGAGGGCCCTGCAGAGAGTCGCCCGGATCAATGGGAAGCGGGAAGAAGGAGCCAAATTGAGTATG
GAG
GTGAGATCCCCTGAGACTTCCCATGATAACCTCCCAGGGCTTCACCCCCAAACCCCAAACCCAGGACCCAGGGCCCA
GGGAACTCCTCTAAGTAAGGGATTAGGCTGGGAG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-II
Assays: SLC22A6_5_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4705
PDE
62748912 GRCh37
62505488 NCBI36
  
CCTAGAAAGCCCAGCCCCAGCCCCC C → G ACCCAGCTGACTGGAACTGAAGCCA
- 
 
n=
C/C=
C/G=
G/G=
G=
154
77
0
0
0.000
156
77
1
0
0.006
112
56
0
0
0.000
96
48
0
0
0.000
10
5
0
0
0.000
Set-II
 
4706
PDE
62748870 GRCh37
62505446 NCBI36
  
CTGAAGCCATGCTGACACCCACCCC C → T ACCCCCGCTCCCAGGTTCTTCATTG
- 
 
n=
C/C=
C/T=
T/T=
T=
154
77
0
0
0.000
156
78
0
0
0.000
112
55
1
0
0.009
96
48
0
0
0.000
10
5
0
0
0.000
Set-II
 
4707
PDE
62748863 GRCh37
62505439 NCBI36
  
CATGCTGACACCCACCCCCACCCCC G → A CTCCCAGGTTCTTCATTGAGTCGGC
- 
 
n=
G/G=
G/A=
A/A=
A=
154
77
0
0
0.000
156
78
0
0
0.000
112
55
1
0
0.009
96
48
0
0
0.000
10
5
0
0
0.000
Set-II
Exon 5: Coding
4708
62748801 GRCh37
62505377 NCBI36
1185852
CCTCCTCCGGGAGGCTGGACCTCAC A → C CTGAGGGCCCTGCAGAGAGTCGCCC
-284
Thr = Thr
n=
A/A=
A/C=
C/C=
C=
154
0
0
77
1.000
156
0
0
78
1.000
112
0
0
56
1.000
96
0
0
48
1.000
10
0
0
5
1.000
Set-II
Exon 5: Coding
4709
PDE
1 pub
62748776 GRCh37
62505352 NCBI36
1210877
ACTGAGGGCCCTGCAGAGAGTCGCC C → T GGATCAATGGGAAGCGGGAAGAAGG
-293
Arg → Trp
(D=101)
n=
C/C=
C/T=
T/T=
T=
154
74
3
0
0.019
156
78
0
0
0.000
112
56
0
0
0.000
96
48
0
0
0.000
10
5
0
0
0.000
Set-II
 
4710
PDE
I
62748699 GRCh37
62505275 NCBI36
  
CCCCTGAGACTTCCCATGATAACCT C → T CCAGGGCTTCACCCCCAAACCCCAA
- 
 
n=
C/C=
C/T=
T/T=
T=
154
77
0
0
0.000
156
78
0
0
0.000
112
37
15
4
0.205
96
48
0
0
0.000
10
4
1
0
0.100
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.