UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004790
NM_153276
NM_153277
NM_153278
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004790 [Chr.11(-): 62744069-62752495 GRCh37]
Id:SLC22A6_exon6
Position:Chr.11(-): 62748322-62748659 GRCh37
Chr.11(-): 62504898-62505235 NCBI36
Sequence:
GCCCAGGGAACTCCTCTAAGTAAGGGATTAGGCTGGGAGGAGCTCCTTGGGAGGATCCCGGGCCCTGAGCTCTGCCGGTC
CCAGCAGGTACTCCGGGCCAGTCTGCAGAAGGAGCTGACCATGGGCAAAGGCCAGGCATCGGCCATGGAGCTGCTGCGCT
GCCCCACCCTCCGCCACCTCTTCCTCTGCCTCTCCATGCTGTG
GTAGGCCCAGAAAGACAGACAGACTGAGACAAAAGGC
TGGCTGGGGCAGGAGGAGACACAATGGGTGAAAGAGGCCAGAGAAGAGGGCAGGAAGGTCAGCAGACCTGCTGTGAGAAG
CAGTAACCCCACACTAGG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-II
Assays: SLC22A6_6_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4711
PDE
62748601 GRCh37
62505177 NCBI36
  
TGGGAGGAGCTCCTTGGGAGGATCC C → T GGGCCCTGAGCTCTGCCGGTCCCAG
- 
 
n=
C/C=
C/T=
T/T=
T=
154
58
17
2
0.136
158
79
0
0
0.000
116
58
0
0
0.000
100
50
0
0
0.000
10
5
0
0
0.000
Set-II
 
4712
PDE
62748440 GRCh37
62505016 NCBI36
  
CATGCTGTGGTAGGCCCAGAAAGAC A → C GACAGACTGAGACAAAAGGCTGGCT
- 
 
n=
A/A=
A/C=
C/C=
C=
154
77
0
0
0.000
158
79
0
0
0.000
116
58
0
0
0.000
100
49
1
0
0.010
10
5
0
0
0.000
Set-II
 
4713
PDE
62748416 GRCh37
62504992 NCBI36
  
CAGACAGACTGAGACAAAAGGCTGG C → T TGGGGCAGGAGGAGACACAATGGGT
- 
 
n=
C/C=
C/T=
T/T=
T=
154
77
0
0
0.000
158
79
0
0
0.000
116
57
1
0
0.009
100
50
0
0
0.000
10
5
0
0
0.000
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.