UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004790
NM_153276
NM_153277
NM_153278
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004790 [Chr.11(-): 62744069-62752495 GRCh37]
Id:SLC22A6_exon7
Position:Chr.11(-): 62747104-62747503 GRCh37
Chr.11(-): 62503680-62504079 NCBI36
Sequence:
ATGCAGTTCCCCCACTGTTTTGAAAGAGCACCCCACTTTAAGCCTTCCTAACAAACTCCATACTCCTCTCTTCTCTCTGC
TAGGTTTGCCACTAGCTTTGCATACTATGGGCTGGTCATGGACCTGCAGGGCTTTGGAGTCAGCATCTACCTAATCCAGG
TGATCTTTGGTGCTGTGGACCTGCCTGCCAAGCTTGTGGGCTTCCTTGTCATCAACTCCCTGGGTCGCCGGCCTGCCCAG
ATGGCTGCACTGCTGCTGGCAGGCATCTGCATCCTGCT
CAATGGGGTGATACCCCAGGGTGAGCACCCACGAGCACCTTG
GCCCCTTCTCCTCAGCCCCATCCCCACACATAACCCAATATCTCAGAAGGGAGGGGGCCAATTCCTCCTAGCCTCCACTC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-II
Assays: SLC22A6_7_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4714
PDE
62747434 GRCh37
62504010 NCBI36
  
TTCCTAACAAACTCCATACTCCTCT C → T TTCTCTCTGCTAGGTTTGCCACTAG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
118
58
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 7: Coding
4715
PDE
62747225 GRCh37
62503801 NCBI36
15661233
TGCTGGCAGGCATCTGCATCCTGCT C → T AATGGGGTGATACCCCAGGGTGAGC
-411
Leu = Leu
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
118
58
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 
4716
PDE
62747194 GRCh37
62503770 NCBI36
  
GGTGATACCCCAGGGTGAGCACCCA C → T GAGCACCTTGGCCCCTTCTCCTCAG
- 
 
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 
4717
PDE
62747145 GRCh37
62503721 NCBI36
  
AGCCCCATCCCCACACATAACCCAA T → C ATCTCAGAAGGGAGGGGGCCAATTC
- 
 
n=
T/T=
T/C=
C/C=
C=
160
0
6
74
0.963
160
0
0
80
1.000
118
0
0
59
1.000
100
0
0
50
1.000
12
0
0
6
1.000
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.