UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004790
NM_153276
NM_153277
NM_153278
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004790 [Chr.11(-): 62744069-62752495 GRCh37]
Id:SLC22A6_exon8
Position:Chr.11(-): 62746840-62747192 GRCh37
Chr.11(-): 62503416-62503768 NCBI36
Sequence:
AGCACCTTGGCCCCTTCTCCTCAGCCCCATCCCCACACATAACCCAATATCTCAGAAGGGAGGGGGCCAATTCCTCCTAG
CCTCCACTCCCAAGCTCCTGCTATCCCCCCTTCTTTCTCTCTAGACCAGTCCATTGTCCGAACCTCTCTTGCTGTGCTGG
GGAAGGGTTGTCTGGCTGCCTCCTTCAACTGCATCTTCCTGTATACTGGGGAACTGTATCCCACAATGATCC
GGTGAGTG
GGAGCCTAATGGGAGAATGACAGCCTTTTCCTGGGGAAAGACATTCTTCTGTGCACAGGTCAGACCCCAGAGCTAAATCA
AGTACATCCCAGCCCAAAGGCCCCTCCCAACAC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-II
Assays: SLC22A6_8_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4717
PDE
62747145 GRCh37
62503721 NCBI36
  
AGCCCCATCCCCACACATAACCCAA T → C ATCTCAGAAGGGAGGGGGCCAATTC
- 
 
n=
T/T=
T/C=
C/C=
C=
158
0
6
73
0.962
160
0
0
80
1.000
118
0
0
59
1.000
100
0
0
50
1.000
12
0
0
6
1.000
Set-II
Exon 8: Coding
4718
PDE
1 pub
62746960 GRCh37
62503536 NCBI36
16941361
GGGGAACTGTATCCCACAATGATCC G → A GTGAGTGGGAGCCTAATGGGAGAAT
No difference in renal clearance and secretory clearance of adefovir in family-based studies. PMID: 19940846.
-454
Arg → Gln
(D=43)
n=
G/G=
G/A=
A/A=
A=
158
78
1
0
0.006
160
80
0
0
0.000
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 
4719
PDE
62746904 GRCh37
62503480 NCBI36
  
CCTTTTCCTGGGGAAAGACATTCTT C → T TGTGCACAGGTCAGACCCCAGAGCT
- 
 
n=
C/C=
C/T=
T/T=
T=
158
78
1
0
0.006
160
74
6
0
0.037
118
59
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 
4720
PDE
62746895 GRCh37
62503471 NCBI36
  
GGGGAAAGACATTCTTCTGTGCACA G → A GTCAGACCCCAGAGCTAAATCAAGT
- 
 
n=
G/G=
G/A=
A/A=
A=
158
79
0
0
0.000
160
79
1
0
0.006
118
59
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.