UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004790
NM_153276
NM_153277
NM_153278
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004790 [Chr.11(-): 62744069-62752495 GRCh37]
Id:SLC22A6_exon9
Position:Chr.11(-): 62744546-62744942 GRCh37
Chr.11(-): 62501122-62501518 NCBI36
Sequence:
AGCTGCCACCCTCCAAATGGGACCAGCATCTGGGCATTCATGCTGGAACTCTAACCAACACCCATCTGCTGCGGGCCCTG
CAGGCAGACAGGCATGGGAATGGGCAGCACCATGGCCCGAGTGGGCAGCATCGTGAGCCCACTGGTGAGCATGACTGCCG
AGCTCTACCCCTCCATGCCTCTCTTCATCTA
CGGTGCTGTTCCTGTGGCCGCCAGCGCTGTCACTGTCCTCCTGCCAGAG
ACCCTGGGCCAGCCACTGCCAGACACGGTGCAGGACCTGGAGAGCAGGTGGGCCCCCACTCAGAAAGAAGCAGGGATATA
TCCCAG
GTAACACATGCAGGGTGGGGTGGTATTGAGACTCAAGCCCAGGCTTCCTCTTCTAGCCCAAAGCTCTGTGT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-II
Assays: SLC22A6_9_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4721
PDE
IA
62744899 GRCh37
62501475 NCBI36
  
GGGACCAGCATCTGGGCATTCATGC T → C GGAACTCTAACCAACACCCATCTGC
- 
 
n=
T/T=
T/C=
C/C=
C=
160
1
8
71
0.938
160
5
26
49
0.775
118
0
12
47
0.898
92
5
13
28
0.750
12
1
3
2
0.583
Set-II
Exon 9: Coding
4722
PDE
I
62744751 GRCh37
62501327 NCBI36
18031470
ACCCCTCCATGCCTCTCTTCATCTA C → T GGTGCTGTTCCTGTGGCCGCCAGCG
-490
Tyr = Tyr
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
160
80
0
0
0.000
118
59
0
0
0.000
92
46
0
0
0.000
12
6
0
0
0.000
Set-II
 
4723
PDE
62744597 GRCh37
62501173 NCBI36
  
TCCCAGGTAACACATGCAGGGTGGG G → A TGGTATTGAGACTCAAGCCCAGGCT
- 
 
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
118
59
0
0
0.000
92
46
0
0
0.000
12
6
0
0
0.000
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.