UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004790
NM_153276
NM_153277
NM_153278
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004790 [Chr.11(-): 62744069-62752495 GRCh37]
Id:SLC22A6_exon10
Position:Chr.11(-): 62744233-62744379 GRCh37
Chr.11(-): 62500809-62500955 NCBI36
Sequence:
AGTGCCATTCTTCTGCCGCCCTGCAGGAAAGGGAAACAGACGCGACAGCAACAAGAGCACCAGAAGTATATGGTCCCACT
GCAGGCCTCAGCACAAGAGAAGAATGGACTCTGA
GGACTGAGAAGGGGCCTTACAGAACCCTAAAGG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-II
Assays: SLC22A6_10_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsSample Set
no variants

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.