UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_032583
NM_033151
NM_145186
XM_005256209
XM_005256210
XM_005256208
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_032583 [Chr.16(-): 48200822-48269088 GRCh37]
Id:ABCC11-P SEQ
Position:Chr.16(+): 48268888-48269638 GRCh37
Chr.16(+): 46826389-46827139 NCBI36
Sequence:
AATTATTTGATAAAATGACTTAAATTATTGGCTCAAACAAGGTCTTAAAATGGTAAGCCAAAACATTTATTTTTCCCTCA
TTAACCAGCAAGTGGGGGATCATGAGGAAGACCAGATTTATAAAGACCAAGTAAAGAAATTAGATTTTCTCTCACCTTTC
AGCTATAGTATGATTTGCCAACCTGGTTTATTCAAATACAC
CTGCAAAGAGAGGTAACGAAGGTTTCACAACTAGAGATG
CAAAGAGATGCAAAGAGATGCAATGAGGGTTACTCATCACATTCTGAAATTACCATTTCTTTCCTTGTTGGCTTATTTGT
TTTCTGCATACCTCATTAGAATGTAAGCTCTTTGAAACCAGGGACCTTGTCTGTCCTGTTCACAAATGTGTCTTTGGATC
TAGAAGAGTGCCCAGCACATAGTGTGACTCTTTCCTATTCAAGATTCATCCAGGAAACTAACGACATGGAAAATGAAACC
CAACGAAAATTAAGAAAATGCAAACATTGTAATAGTTATGTTTGCAGAACATCAGTCGCTCATCCCAAGCAAACGAGCTC
GAGCTCAGCCACACATTAGCTTGGGCCTCCTTCCAGTTCCATGGGGCCCATCTCCACTTCCTGGACTGACCAGGGGAATT
CCCTCCAGAACCTTCCTTGGCAGTCCCGGAAGCATTCCCTGGACTCCCAATTCTCTTTCCGGAAGAAAATGGAGCTGGAG
TTTATTCACTCTAATTGGTGTAAGACCATCA
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: ABCC11-P
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Promoter
4241
PDE
48269101 GRCh37
46826602 NCBI36
-13-3269
TATTCAAATACACCTGCAAAGAGAG G → C TAACGAAGGTTTCACAACTAGAGAT
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
64
2
0
0.015
130
65
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Promoter
4242
48269141 GRCh37
46826642 NCBI36
-53-3309
CAACTAGAGATGCAAAGAGATGCAA AGAGATGCAA → - TGAGGGTTACTCATCA
+ 
 
n=
AGAGATGCAA/AGAGATGCAA=
AGAGATGCAA/-=
-/-=
-=
132
40
20
6
0.242
130
56
8
1
0.077
136
63
5
0
0.037
132
51
13
2
0.129
PMT-272
Promoter
5131
PDE
48269333 GRCh37
46826834 NCBI36
-245-3501
AGTGTGACTCTTTCCTATTCAAGAT T → C CATCCAGGAAACTAACGACATGGAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
92
45
1
0
0.011
114
57
0
0
0.000
126
63
0
0
0.000
106
53
0
0
0.000
PMT-272
 
4244
PDE
48269464 GRCh37
46826965 NCBI36
-376-3632
AACGAGCTCGAGCTCAGCCACACAT T → G AGCTTGGGCCTCCTTCCAGTTCCAT
+ 
 
n=
T/T=
T/G=
G/G=
G=
92
46
0
0
0.000
114
56
1
0
0.009
126
63
0
0
0.000
106
53
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.