UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001650
NM_004028
XM_005258257
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001650 [Chr.18(-): 24432007-24445716 GRCh37]
Id:TBI_Exon_1
Position:Chr.18(-): 24445484-24446010 GRCh37
Chr.18(-): 22699482-22700008 NCBI36
Sequence:
AATTGCCCAATTTCAACTACAACATATAACCAAACAAGACAAATTCTGAACAATTCTTCATGGTAGAAAGAATTCAAATA
AAGATTTAAGGAAATCCTCATTTTCAAAAATTACTGTCTCAAAAAAAAAAAAATTAAGTAAATGTTTTTGCATTCCTGAA
ATGCCCTGTGTCTACAGTGATCAGGTACAGAAAAGCTACTTCAAGTTCAAATATAACTTAGCGATTGCCACATGGTGCAG
AATCTTTCCACCCCTAACACTCCAAAAACCCAATCAGACAAGTGGCCGTAATCTGACTCCCAGCACACAGGGAGCTGCGG
GGCAGGCAATGAGAGCTGCACTCTGGCTGGGGAAGGC
ATGAGTGACAGACCCACAGCAAGGCGGTGGGGGTAAGTCCTTC
TTTGCCTTAAGGGAACAACGCTTAGGGCCAAAAGATGAAACTGTCTCTTTTATTATAGATGTTTGTGCCTTCTTAGGCAG
AATCTGGAAGGCAGCTATAGGGCAGGTGGGTGGTTCTTTTAGATCTG
Color Legend: SNP  UTR  CODING
Sample Sets: AQP4_TBI
Assays: AQP4-1
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqHispanic FreqUnknown FreqSample Set
Promoter
3129
PDE
A
24445847 GRCh37
22699845 NCBI36
-131-194
TAAATGTTTTTGCATTCCTGAAATG C → T CCTGTGTCTACAGTGATCAGGTACA
- 
 
n=
C/C=
C/T=
T/T=
T=
12
5
1
0
0.083
24
7
5
0
0.208
8
1
3
0
0.375
16
6
2
0
0.125
4
2
0
0
0.000
AQP4_TBI

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.