UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001650
NM_004028
XM_005258257
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001650 [Chr.18(-): 24432007-24445716 GRCh37]
Id:TBI_Exon_2
Position:Chr.18(-): 24441984-24442687 GRCh37
Chr.18(-): 22695982-22696685 NCBI36
Sequence:
TTGGTGTGCAAATCACGCCTGGCAGCCCCTGCCCACAGTACCCGAAGATGGCAGGCCTTGTTCCCTTCACCTAAATTCAT
AAACCTGGGTGTAGTGGCTTCTGATGCTGATTTGTTTCTCTTTTCAGTAAGTGTGGACCTTTGTGTACCAGAGAGAACAT
CATGGTGGCTTTCAAAGGGGTCTGGACTCAAGCTTTCTGGAAAGCAGTCACAGCGGAATTTCTGGCCATGCTTATTTTTG
TTCTCCTCAGCCTGGGATCCACCATCAACTGGGGTGGAACAGAAAAGCCTTTACCGGTCGACATGGTTCTCATCTCCCTT
TGCTTTGGACTCAGCATTGCAACCATGGTGCAGTGCTTTGGCCATATCAGCGGTGGCCACATCAACCCTGCAGTGACTGT
GGCCATGGTGTGCACCAGGAAGATCAGCATCGCCAAGTCTGTCTTCTACATCGCAGCCCA
GTGCCTGGGGGCCATCATTG
GAGCAGGAATCCTCTATCTGGTCACACCTCCCAGTGTGGTGGGAGGCCTGGGAGTCACCATG
GTAGCATCTTTAGCTATT
TTCAAACTAGGACTCCAAGCTTCTTGCAAACTCTTTGCTAAATAATGCCTTGGTGGCATGAGGCACATCCCTAAAATAGC
TAATTTACTCCTAGGGAATTTTTGATGATTCTTAATAGTGTGAAAACTGATTCTGGCAGTATTT
Color Legend: SNP  UTR  CODING
Sample Sets: AQP4_TBI
Assays: AQP4-2
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqHispanic FreqUnknown FreqSample Set
Exon 2: Coding
3218
PDE
1 pub
24442227 GRCh37
22696225 NCBI36
429366
AGTCTGTCTTCTACATCGCAGCCCA G → A TGCCTGGGGGCCATCATTGGAGCAG
-122
Gln = Gln
n=
G/G=
G/A=
A/A=
A=
12
5
1
0
0.083
24
12
0
0
0.000
8
4
0
0
0.000
16
8
0
0
0.000
4
2
0
0
0.000
AQP4_TBI
 
3220
PDE
24442130 GRCh37
22696128 NCBI36
  
AGTCACCATGGTAGCATCTTTAGCT A → G TTTTCAAACTAGGACTCCAAGCTTC
- 
 
n=
A/A=
A/G=
G/G=
G=
12
4
2
0
0.167
24
12
0
0
0.000
8
4
0
0
0.000
16
8
0
0
0.000
4
2
0
0
0.000
AQP4_TBI
 
3222
PDE
24442056 GRCh37
22696054 NCBI36
  
GCCTTGGTGGCATGAGGCACATCCC T → C AAAATAGCTAATTTACTCCTAGGGA
- 
 
n=
T/T=
T/C=
C/C=
C=
12
6
0
0
0.000
24
7
5
0
0.208
8
2
1
1
0.375
16
6
2
0
0.125
4
2
0
0
0.000
AQP4_TBI

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.