UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001650
NM_004028
XM_005258257
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001650 [Chr.18(-): 24432007-24445716 GRCh37]
Id:TBI_Exon_5_2
Position:Chr.18(-): 24435664-24436256 GRCh37
Chr.18(-): 22689662-22690254 NCBI36
Sequence:
AGTGGTGCATGTGATTGACGTTGACCGGGGAGAGGAGAAGAAGGGGAAAGACCAATCTGGAGAGGTATTGTCTTCAGTAT
GA
CTAGAAGATCGCACTGAAAGCAGACAAGACTCCTTAGAACTGTCCTCAGATTTCCTTCCACCCATTAAGGAAACAGAT
TTGTTATAAATTAGAAATGTGCAGGTTTGTTGTTTCATGTCATATTACTCAGTCTAAACAATAAATATTTCATAATTTAC
AAAGGAGGAACGGAAGAAACCTATTGTGAATTCCAAATCTAAAAAAAGAAATATTTTTAAAATGTTCTTAAGCAAATATA
TACCTATTTTATCTAGTTACCTTTCATTAACAACCAATTTTAACCGTGTGTCAAGATTTGGTTAAGTCTTGCCTGACAGA
ACTCAAAGACACGTCTATCAGCTTATTCCTTCTCTACT
GGAATATTGGTATAGTCAATTCTTATTTGAATATTTATTCTA
TTAAACTGAGTTTAACAATGGCAAAATACAGTATGTCACAGTCATGCACATTCAAGAGAGAAAATATAACAAGTTCTTTT
ATGAGCAAT
CCCTTATGCATAGACTACCTTGGC
Color Legend: SNP  UTR  CODING
Sample Sets: AQP4_TBI
Assays: AQP4-5_2
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqHispanic FreqUnknown FreqSample Set
Exon 5: 3UTR
3152
PDE
4 pubsI
24435818 GRCh37
22689816 NCBI36
1392 
TCTATCAGCTTATTCCTTCTCTACT G → A GAATATTGGTATAGTCAATTCTTAT
- 
 
n=
G/G=
G/A=
A/A=
A=
12
5
1
0
0.083
24
6
5
1
0.292
8
2
1
1
0.375
16
0
4
4
0.750
4
0
1
1
0.750
AQP4_TBI

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.