UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1_exon3UTR
Position:Chr.7(-): 87133052-87133670 GRCh37
Chr.7(-): 86970988-86971606 NCBI36
Sequence:
GGTGTTTCAGAATGGCAGAGTCAAGGAGCATGGCACGCATCAGCAGCTGCTGGCACAGAAAGGCATCTATTTTTCAATGG
TCAGTGTCCAGGCTGGAACAAAGCGCCAGTGA
ACTCTGACTGTATGAGATGTTAAATACTTTTTAATATTTGTTTAGATA
TGACATTTATTCAAAGTTAAAAGCAAAC
ACTTACAGAATTATGAAGAGGTATCTGTTTAACATTTCCTCAGTCAAGTTCA
GAGTCTTCAGAGACTTC
GTAATTAAAGGAACAGAGTGAGAGACATCATCAAGTGGAGAGAAATCATAGTTTAAACTGCAT
TATAAATTTTATAACAGAATTAAAGTAGATTTTAAAAGATAAA
ATGTGTAATTTTGTTTATATTTTCCCATTTGGACTGT
AACTGACTGCCTTGCTAAAAGATTATA
GAAGTAGCAAAAAGTATTGAAATGTTTGCATAAAGTGTCTATAATAAAACTAA
ACTTTCATGTGA
CTGGAGTCATCTTGTCCAAACTGCCTGTGAATATATCTTCTCTCAATTGGAATATTGTAGATAACTTC
TGCTTTAAAAAAGTTTTCTTTAAATATACCTACTCATTTTTGTGGGAATGGTTAAGCAG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCB1_3UTR_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 29: 3UTR
3704
PDE
1 pubI
87133538 GRCh37
86971474 NCBI36
4357 
AGTGAACTCTGACTGTATGAGATGT T → C AAATACTTTTTAATATTTGTTTAGA
- 
 
n=
T/T=
T/C=
C/C=
C=
200
84
16
0
0.080
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 29: 3UTR
5281
PDE
87133482 GRCh37
86971418 NCBI36
4413 
CATTTATTCAAAGTTAAAAGCAAAC A → - CTTACAGAATTATGAAGAGGTATCT
- 
 
n=
A/A=
A/-=
-/-=
-=
200
87
12
1
0.070
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 29: 3UTR
5282
PDE
87133481 GRCh37
86971417 NCBI36
4414 
ATTTATTCAAAGTTAAAAGCAAACA C → - TTACAGAATTATGAAGAGGTATCTG
- 
 
n=
C/C=
C/-=
-/-=
-=
200
87
12
1
0.070
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 29: 3UTR
5283
PDE
87133480 GRCh37
86971416 NCBI36
4415 
TTTATTCAAAGTTAAAAGCAAACAC T → - TACAGAATTATGAAGAGGTATCTGT
- 
 
n=
T/T=
T/-=
-/-=
-=
200
87
12
1
0.070
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 29: 3UTR
5284
PDE
87133479 GRCh37
86971415 NCBI36
4416 
TTATTCAAAGTTAAAAGCAAACACT T → - ACAGAATTATGAAGAGGTATCTGTT
- 
 
n=
T/T=
T/-=
-/-=
-=
200
87
12
1
0.070
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 29: 3UTR
5285
PDE
1 pubI
87133470 GRCh37
86971406 NCBI36
4425 
GTTAAAAGCAAACACTTACAGAATT A → T TGAAGAGGTATCTGTTTAACATTTC
- 
 
n=
A/A=
A/T=
T/T=
T=
200
79
20
1
0.110
200
87
13
0
0.065
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 29: 3UTR
5286
PDE
1 pubI
87133413 GRCh37
86971349 NCBI36
4482 
CAAGTTCAGAGTCTTCAGAGACTTC G → A TAATTAAAGGAACAGAGTGAGAGAC
- 
 
n=
G/G=
G/A=
A/A=
A=
200
84
14
2
0.090
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 29: 3UTR
5287
87133391 GRCh37
86971327 NCBI36
4504 
TTCGTAATTAAAGGAACAGAGTGAG A → AGACAGAGA GACATCATCAAGTGGAGAGAAATCA
- 
 
n=
A/A=
A/AGACAGAGA=
AGACAGAGA/AGACAGAGA=
AGACAGAGA=
200
81
19
0
0.095
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 29: 3UTR
5288
PDE
7 pubsI
87133366 GRCh37
86971302 NCBI36
4529 
AGACATCATCAAGTGGAGAGAAATC A → G TAGTTTAAACTGCATTATAAATTTT
- 
 
n=
A/A=
A/G=
G/G=
G=
200
76
22
2
0.130
200
73
26
1
0.140
60
22
7
1
0.150
20
9
1
0
0.050
14
0
4
3
0.714
Set-I
Exon 29: 3UTR
5289
PDE
1 pubI
87133307 GRCh37
86971243 NCBI36
4588 
ATTAAAGTAGATTTTAAAAGATAAA A → C TGTGTAATTTTGTTTATATTTTCCC
- 
 
n=
A/A=
A/C=
C/C=
C=
200
91
9
0
0.045
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 29: 3UTR
5290
PDE
1 pubI
87133243 GRCh37
86971179 NCBI36
4652 
CTGACTGCCTTGCTAAAAGATTATA G → A AAGTAGCAAAAAGTATTGAAATGTT
- 
 
n=
G/G=
G/A=
A/A=
A=
200
94
6
0
0.030
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 29: 3UTR
5291
PDE
87133204 GRCh37
86971140 NCBI36
4691 
TATTGAAATGTTTGCATAAAGTGTC T → C ATAATAAAACTAAACTTTCATGTGA
- 
 
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
5292
PDE
87133166 GRCh37
86971102 NCBI36
  
AACTTTCATGTGACTGGAGTCATCT T → C GTCCAAACTGCCTGTGAATATATCT
- 
 
n=
T/T=
T/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
28
2
0
0.033
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.