UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004174
XM_005248354
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004174 [Chr.5(-): 473334-524549 GRCh37]
Id:SLC9A3-P SEQ
Position:Chr.5(-): 524294-525222 GRCh37
Chr.5(-): 577294-578222 NCBI36
Sequence:
AAGCCCTGGGGGTATCGAATTGTTTTGGGCGGAGGTCTAAAGGCAGGGGATGGGGCAGGGGAGACCACGGGGGCCCCTGG
GCTCCCATCTCAGAGCCTGGGGTGGGGGATGCTGGCTGGCGATGGGAGGGGCAGAGAGACTTACCAGCGCACCACGCAAG
GCCTGGGCGCCCCCGAGTTCTGGTAAGTGGCCGGTCCGGCTGTGGAATGCAGGTTCCTGCTGAAGACAATAGCGAGGGGC
TGTGTGAAGACACACCTGGGGCCCCTGTGCACCCTTGGGCCGCCCTGTGGGGTCTGCGCAGCCCCAGGCCCTGCGTTTAT
GAAGGAGGGTTGGGGCGAGCGCACCCACAGCTGCCCGGGCATCCCAGGAGCTGCGCGGAACCGCCTGTCCCGCTGCCCCG
CGCTGTGCTCCCCACGCCCCAGGAAGGCGGCCGCGCAGTCCCGGGCTCGCTCTTGCCGCGACCTCCCGGACCTCCAGGCC
GCGGGCTCCGGGGGAGGGTGGGCACCAGGGAGCGCGGGGTGGGCGTGCGCGGGCGGGGCGGGCGTGCCGGGAGCTGCGGC
GGTGTCTGCGCTCGCGAGTGCGCGGCGGGGGCGGGCAGGCTCCGCCCCGGGGCGGGAGGGGGCCGCGGGATTAAAGGCCA
CCCCGGCGGGCGGGGATCGGACTGTAGCCGGTACCGGCACCGGAGCGCGCCGGGTCCTCGCCGGGTCCCAGCCCCGCGCG
TC
GGCCCAGCCCAGCCGGGACCCCCCGCGACATGCGCGTCCCAGCCCTGCGCTGAGCAGGCGGCAATGTGGGGACTCGGG
GCCCGGGGCCCCGACCGGGGGCTGCTGCTGGCGCTGGCGCTGGGCGGGCTGGCGCGGGCCGGGGGCGTCGAGGTGGAGCC
CGGCGGCGCGCACGGCGAGAGCGGGG
GCTTCCAGGTGGTCACCTTCGAG
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: SLC9A3-P
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Promoter
3021
PDE
524785 GRCh37
577785 NCBI36
-236-348
CACGCCCCAGGAAGGCGGCCGCGCA G → A TCCCGGGCTCGCTCTTGCCGCGACC
- 
 
n=
G/G=
G/A=
A/A=
A=
114
57
0
0
0.000
132
66
0
0
0.000
126
61
2
0
0.016
126
63
0
0
0.000
PMT-272
Promoter
3022
PDE
524772 GRCh37
577772 NCBI36
-223-335
GGCGGCCGCGCAGTCCCGGGCTCGC T → C CTTGCCGCGACCTCCCGGACCTCCA
- 
 
n=
T/T=
T/C=
C/C=
C=
114
35
19
3
0.219
132
42
22
2
0.197
126
61
2
0
0.016
126
41
21
1
0.183
PMT-272
Promoter
3023
524637 GRCh37
577637 NCBI36
-88-200
GGTGTCTGCGCTCGCGAGTGCGCGG C → T GGGGGCGGGCAGGCTCCGCCCCGGG
- 
 
n=
C/C=
C/T=
T/T=
T=
114
57
0
0
0.000
132
66
0
0
0.000
126
62
1
0
0.008
126
63
0
0
0.000
PMT-272
Promoter
3024
PDE
524554 GRCh37
577554 NCBI36
-5-117
CGGCGGGCGGGGATCGGACTGTAGC C → G GGTACCGGCACCGGAGCGCGCCGGG
- 
 
n=
C/C=
C/G=
G/G=
G=
114
46
11
0
0.096
132
57
9
0
0.068
126
22
31
10
0.405
126
49
14
0
0.111
PMT-272
Exon 1: 5UTR
Promoter
3025
524512 GRCh37
577512 NCBI36
38-75
CGCGCCGGGTCCTCGCCGGGTCCCA GCGCCCCCCAGGGCCGACCCGACCCGGCTGCGCGCCCC → - 
- 
 
n=
GCGCCCCCCAGGGCCGACCCGACCCGGCTGCGCGCCCC/GCGCCCCCCAGGGCCGACCCGACCCGGCTGCGCGCCCC=
GCGCCCCCCAGGGCCGACCCGACCCGGCTGCGCGCCCC/-=
-/-=
-=
114
57
0
0
0.000
132
66
0
0
0.000
126
63
0
0
0.000
126
62
1
0
0.008
PMT-272
Exon 1: 5UTR
Promoter
3026
PDE
524500 GRCh37
577500 NCBI36
50-63
TCGCCGGGTCCCAGCCCCGCGCGTC G → A GCCCAGCCCAGCCGGGACCCCCCGC
- 
 
n=
G/G=
G/A=
A/A=
A=
114
52
5
0
0.044
132
66
0
0
0.000
126
63
0
0
0.000
126
63
0
0
0.000
PMT-272
Exon 1: 5UTR
3027
PDE
524479 GRCh37
577479 NCBI36
71-42
CGTCGGCCCAGCCCAGCCGGGACCC C → T CCGCGACATGCGCGTCCCAGCCCTG
- 
 
n=
C/C=
C/T=
T/T=
T=
114
57
0
0
0.000
132
66
0
0
0.000
126
62
1
0
0.008
126
63
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.