UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_021082
NM_001145998
XM_005247722
XM_005247723
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_021082 [Chr.3(+): 121613171-121663034 GRCh37]
Id:SLC15A2-P SEQ
Position:Chr.3(+): 121612496-121613445 GRCh37
Chr.3(+): 123095186-123096135 NCBI36
Sequence:
GAACAAATTTCTTAACCTCTGGGAACATTACTTTCTATAAAATGGGGATAGTAATATGAATTAGAATAAATATATATGTT
ATAGATATACAACATAGATGTAATTCATATATATTAACCTTTCAATAGTAGATGTTCAATAAATTACAGCTATTGTTACC
CTGAAATCAGTTTTTCTTTTTTTTTTTTTTTGGAAATGGAGTTTCGCTCTTGTTGCCCAGGCTGGAGTGCAATGGTGCAA
TCTCAGCTCACCGCAACCTCCGCCTCCCAGGTTCAAGTGATTCTTCTGCCTTAGCCTCCTGAGTAGCTGGGATTATAGGC
GCCCGCCACCACACCCAGCTAATTTTTTTTTTGTATTTTTAGTAGAGACGGGGTTTCACCATGTGGGCCAGGCTGCTGAC
CTAAAACGATCCGCCTGCCTGGGCCTTCCAAAGTGCTAGGATTATATGCGTGAACCACCGCGCCTGACCATGGAATCAGT
TTTTCAATCTGTGCTCGAGGTGTTGTGTTCTTAACTATCTTCTACTCCTTTGCAAAGATAATCTTTCTTAAACATAGATT
TTCTAATCAGTTCTCTAGCATTGTTTCATTCTGTCTTTGGCATGTTTTCACTTTGCTGTGCTGTACTTTTACACATTCTT
TTTAACTATAGCTTCCTGCTTTGCTCTGGATCAGGAAGCTATTGAAGCTGACACCCACAGAGTTAAACTCAGTTGCTGAA
GCCACCAGCTCCCC
CTCCCAGTCCTTCTTTTCAGAGTAGGCTGGCAGCTGTCCTAACTGCCTACTAAAGCCAAATGCTTG
AGGAGAGAGAGAGAGTAAGGAGCCAGCC
ATGAATCCTTTCCAGAAAAATGAGTCCAAGGAAACTCTTTTTTCACCTGTCT
CCATTGAAGAGGTACCACCTCGACCACCTAGCCCTCCAAAGAAG
CCATCTCCGGTGAGTCCTTAGATTCA
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: SLC15A2-P
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Promoter
3032
PDE
I
121613054 GRCh37
123095744 NCBI36
-117-270
AAAGATAATCTTTCTTAAACATAGA T → C TTTCTAATCAGTTCTCTAGCATTGT
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
57
7
1
0.069
134
52
15
0
0.112
134
60
7
0
0.052
132
55
11
0
0.083
PMT-272
Promoter
3033
PDE
121613170 GRCh37
123095860 NCBI36
-1-154
AGCTTCCTGCTTTGCTCTGGATCAG G → C AAGCTATTGAAGCTGACACCCACAG
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
134
66
1
0
0.007
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Promoter
Exon 1: 5UTR
3034
PDE
121613205 GRCh37
123095895 NCBI36
35-119
AAGCTGACACCCACAGAGTTAAACT C → G AGTTGCTGAAGCCACCAGCTCCCCC
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
57
7
1
0.069
134
51
16
0
0.119
134
60
7
0
0.052
132
64
2
0
0.015
PMT-272
Exon 1: 5UTR
3035
PDE
121613230 GRCh37
123095920 NCBI36
60-94
CAGTTGCTGAAGCCACCAGCTCCCC C → T TCCCAGTCCTTCTTTTCAGAGTAGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
134
67
0
0
0.000
134
65
2
0
0.015
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.