UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon32
Position:Chr.10(+): 101611185-101611529 GRCh37
Chr.10(+): 101601175-101601519 NCBI36
Sequence:
CTGGTTATTCTTATAAATGCCTAGACTTGAGATGCTGCTTTCTAAGACTTTTATTTCTTTCTTCCTTGTTTCAGGGTAAT
GGTCCTAGACAA
CGGGAAGATTATAGAGTGCGGCAGCCCTGAAGAACTGCTACAAATCCCTGGACCCTTTTACTTTATGG
CTAAGGAAGCTGGCATTGAGAATGTGAACAGCACAAAATTCTAG
CAGAAGGCCCCATGGGTTAGAAAAGGACTATAAGAA
TAATTTCTTATTTAATTTTATTTTTTATAAAATACAGAATACATACAAAAGTGTGTATAAAA
TGTACGTTTTAAAAAAGG
ATAAGTGAACA
CCCATGAACCTACT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_32_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 32: Coding
3921
PDE
I
101611277 GRCh37
101601267 NCBI36
46664527
GTTTCAGGGTAATGGTCCTAGACAA C → T GGGAAGATTATAGAGTGCGGCAGCC
+1509
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
194
96
1
0
0.005
198
97
2
0
0.010
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 32: Coding
3922
PDE
19 pubsI
101611294 GRCh37
101601284 NCBI36
46834544
CTAGACAACGGGAAGATTATAGAGT G → A CGGCAGCCCTGAAGAACTGCTACAA
+1515
Cys → Tyr
(D=194)
n=
G/G=
G/A=
A/A=
A=
194
63
30
4
0.196
198
84
14
1
0.081
58
29
0
0
0.000
20
9
1
0
0.050
14
6
1
0
0.071
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.