Transcript:	NM_001532 [Chr.11(-): 66129992-66139291 GRCh37]
Id:	SLC29A2_exon1
Position:	Chr.11(-): 66138937-66139121 GRCh37
	Chr.11(-): 65895513-65895697 NCBI36
Sequence:	GCAGGTGCAGGTGCGGCTTCTCTGCCCCTTTCACCCCAGGCGCATCCGCCGCGGCGGCCATGGCGCGAGGAGACGCCCCG CGGGACAGGTGAGTGGGCCCGGGTGCGTTGCAAGTGGCCGGGGGCGTTGCAGACCCGCTCCCTGAAGGCGCTCCGAGGCT CAGAGAAGACCGGATCGAACTACAA Color Legend: SNP  UTR  CODING
Sample Sets:	Set-I
Assays:	SLC29A2_1_PCR

Feature	PMT SNP ID	dbSNP/ PubMed	SNP Array Availability	Genomic Position	Transcript Position	Coding Position	Nucleotide Change	Strand, '+' or '-'	Amino Acid Position	Amino Acid Change	Statistics	AA Freq	CA Freq	AS Freq	ME Freq	PA Freq	Sample Set
Exon 1: Coding	3628 PDE	rs8187643 1 pub		66139050  GRCh37 65895626  NCBI36	242	13	CGCCGCGGCGGCCATGGCGCGAGGA G → T ACGCCCCGCGGGACAGGTGAGTGGG Reduced uptake of guanosine and inosine in oocytes. PMID: 19940846.	-	5	Asp → Tyr (D=160)	n= G/G= G/T= T/T= T=	192 95 1 0 0.005	186 93 0 0 0.000	60 30 0 0 0.000	20 10 0 0 0.000	14 7 0 0 0.000	Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.