UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001532
XM_005273964
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001532 [Chr.11(-): 66129992-66139291 GRCh37]
Id:SLC29A2_exon1
Position:Chr.11(-): 66138937-66139121 GRCh37
Chr.11(-): 65895513-65895697 NCBI36
Sequence:
GCAGGTGCAGGTGCGGCTTCTCTGCCCCTTTCACCCCAGGCGCATCCGCCGCGGCGGCCATGGCGCGAGGAGACGCCCCG
CGGGACAG
GTGAGTGGGCCCGGGTGCGTTGCAAGTGGCCGGGGGCGTTGCAGACCCGCTCCCTGAAGGCGCTCCGAGGCT
CAGAGAAGAC
CGGATCGAACTACAA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC29A2_1_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 138)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 1: Coding
3628
PDE
1 pub
66139050 GRCh37
65895626 NCBI36
24213
CGCCGCGGCGGCCATGGCGCGAGGA G → T ACGCCCCGCGGGACAGGTGAGTGGG
Reduced uptake of guanosine and inosine in oocytes. PMID: 19940846.
-5
Asp → Tyr
(D=160)
n=
G/G=
G/T=
T/T=
T=
192
95
1
0
0.005
186
93
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.