UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001532
XM_005273964
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001532 [Chr.11(-): 66129992-66139291 GRCh37]
Id:SLC29A2_exon4
Position:Chr.11(-): 66136469-66136721 GRCh37
Chr.11(-): 65893045-65893297 NCBI36
Sequence:
AGCCCCCTCTGGCCTGGGCCCCACTGATGCACTCTGCCTGCTTCTGAGCAGCGTCCCGGAGACGGTGCGCATTCTGGGCA
GCCTGCTGGCCATACTGCTGCTCTTTGCCCTGACAGCAGCGCTGGTCAAGGTGGACATGAGCCCCGGACCCTTCTTCTCC
ATCACCATGGCCTCCGTCTGCTTCATCAACT
GTGAGCACCTCCACCCCCTCTCCAGCCAGCCTATGCAGGGCTTCAGCCT
GGCCTCATCATTG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC29A2_4_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 138)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 4: Coding
3632
PDE
1 pubI
66136665 GRCh37
65893241 NCBI36
510281
CTCTGCCTGCTTCTGAGCAGCGTCC C → T GGAGACGGTGCGCATTCTGGGCAGC
-94
Pro → Leu
(D=98)
n=
C/C=
C/T=
T/T=
T=
190
95
0
0
0.000
180
89
1
0
0.006
54
27
0
0
0.000
20
10
0
0
0.000
10
5
0
0
0.000
Set-I
Exon 4: Coding
3633
PDE
1 pubI
66136658 GRCh37
65893234 NCBI36
517288
TGCTTCTGAGCAGCGTCCCGGAGAC G → A GTGCGCATTCTGGGCAGCCTGCTGG
-96
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
190
94
1
0
0.005
180
90
0
0
0.000
54
27
0
0
0.000
20
10
0
0
0.000
10
5
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.