UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001043
NM_001172501
NM_001172504
NM_001172502
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001043 [Chr.16(+): 55690352-55737700 GRCh37]
Id:SLC6A2_exon1
Position:Chr.16(+): 55690482-55690981 GRCh37
Chr.16(+): 54247983-54248482 NCBI36
Sequence:
TCCCGGGTGGTCTTGGGAGTTGCAAGTAGGGAGGAACGGCCGGGTAACCACCTCTTTTCCCTTTATCCAAGCAGAGCCTC
GGCGTGCCCCCAGGACCGGTAAAGTTCCTCTCGCCAGCCGCATCC
ATGCTTCTGGCGCGGATGAACCCGCAGGTGCAGCC
CGAGAACAACGGGGCGGACACGGGTCCAGAGCAGCCCCTTCGGGCGCGCAAAACTGCGGAGCTGCTGGTGGTGAAGGAGC
G
CAACGGCGTCCAGTGCCTGCTGGCGCCCCGCGACGGCGACGCGCAGCCCCGGGAGACCTGGGGCAAGAAGATCGACTTC
CTGCTGTCCGTAGTCGGCTTCGCAGTGGACCTGGCCAACGTGTGGCGCTTCCCCTACCTCTGCTACAAGAACGGCGGCG
G
TGAGCGTGGGGTCGGGCTGGGAATTTGAATCTGGGAGGTCCACTGTCTGCAGCGGTGGCTGGGACAGGAGCTGGAATACA
CACG
GAAGGGAGGCGAGGAG
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC6A2_1_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 1: 5UTR
3928
PDE
55690529 GRCh37
54248030 NCBI36
178-78
CAAGTAGGGAGGAACGGCCGGGTAA C → T CACCTCTTTTCCCTTTATCCAAGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
190
94
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: Coding
3929
PDE
55690627 GRCh37
54248128 NCBI36
27621
CATCCATGCTTCTGGCGCGGATGAA C → A CCGCAGGTGCAGCCCGAGAACAACG
+7
Asn → Lys
(D=94)
n=
C/C=
C/A=
A/A=
A=
190
95
0
0
0.000
192
95
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: Coding
3930
PDE
55690723 GRCh37
54248224 NCBI36
372117
CGGAGCTGCTGGTGGTGAAGGAGCG C → T AACGGCGTCCAGTGCCTGCTGGCGC
+39
Arg = Arg
n=
C/C=
C/T=
T/T=
T=
190
94
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
3931
PDE
I
55690919 GRCh37
54248420 NCBI36
  
CGGGCTGGGAATTTGAATCTGGGAG G → A TCCACTGTCTGCAGCGGTGGCTGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
190
94
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.