UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_152701
XM_005249623
XM_005249624
XM_005249625
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_152701 [Chr.7(+): 48211057-48687091 GRCh37]
Id:ABCA13-P SEQ
Position:Chr.7(+): 48237395-48237984 GRCh37
Chr.7(+): 48207950-48208539 NCBI36
Sequence:
GAATTCAACTTGCATTAAGCTTGAAGTTTTTTTGCCAAAACTAAAAACTCCTACATTTTTATATGAGATGGGAAGAAGCA
TCC
TTTCTATTCTTCCTACCCACAGCTTGTTTACAGAGAGCGGTGTCTGGAAGCTTGGCTGTGCATCAGGGTTATTTCCA
CTCAGTGAATGGGGAAGCTTGTGAATCCTGCAGCTATATGGCTGCTCAGAGCCATTCTGCCTTGAAACATGAGTACTGAC
CCTGGAAGAAAGGTGTTAGATATAAAGGTTTTTCCATTTTGTTTGATTCTTTTTGTCTGAGCCCTTAGATCTCCTTTAAA
TTAATAGCAAGGTTAATAATATAATAATATGATGTTATATATTACAATTTCAACTCAACAGGAATTCCATTTCTGGTAGC
AGGTATATGGACTCATTTCTTCTTTGCATCTATTTCTAGGTTATTTGCAGCCCCGAGATCTACCCAGCTGTGGTGTTATC
CCCTTTGTTCAAAGCCTTCTTTGTAACACTGGATCAAGGTGTAGGAACTTCAGCTATGAAGGGTCAATGGAGCA
TCATTT
TCGGTAAGAGAAACACAA
AGATCTTTTTCA
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: ABCA13-P
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
4181
PDE
48237634 GRCh37
48208189 NCBI36
  
TTCTGCCTTGAAACATGAGTACTGA C → T CCTGGAAGAAAGGTGTTAGATATAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
128
64
0
0
0.000
PMT-272
 
4182
PDE
48237636 GRCh37
48208191 NCBI36
  
CTGCCTTGAAACATGAGTACTGACC C → T TGGAAGAAAGGTGTTAGATATAAAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
136
68
0
0
0.000
130
65
0
0
0.000
128
64
0
0
0.000
PMT-272
 
4183
PDE
I
48237721 GRCh37
48208276 NCBI36
  
CCCTTAGATCTCCTTTAAATTAATA G → C CAAGGTTAATAATATAATAATATGA
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
39
25
2
0.220
136
50
15
3
0.154
130
31
31
3
0.285
128
42
17
5
0.211
PMT-272
 
4184
PDE
I
48237802 GRCh37
48208357 NCBI36
  
AATTCCATTTCTGGTAGCAGGTATA T → C GGACTCATTTCTTCTTTGCATCTAT
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
3
23
40
0.780
136
21
33
14
0.449
130
15
34
16
0.508
128
11
27
26
0.617
PMT-272
 
5870
48237824 GRCh37
48208379 NCBI36
  
ATATGGACTCATTTCTTCTTTGCAT C → T TATTTCTAGGTTATTTGCAGCCCCG
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
39
25
2
0.220
136
50
15
3
0.154
130
31
32
2
0.277
128
41
19
4
0.211
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.