UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_020372
NM_016609
XM_005267748
XM_005267747
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_020372 [Chr.14(-): 23815527-23821479 GRCh37]
Id:SLC22A17-P SEQ
Position:Chr.14(+): 23821279-23822029 GRCh37
Chr.14(+): 22891119-22891869 NCBI36
Sequence:
TGGCGGCGCTGGCTGCTAGGGCAGCGCTGGCGACGCTGACGCCGCTGGCATTGGGAGGCTGCTCCCAGCCAGAGGCATTA
G
GGGGGAAGGCCCCGTAGTGGCAATGCAGCGGGGGCGCCAGCGTGAAGATGGGGTCCGAGGCCATGCCCAGAGCCACGAA
GAGCACCGGCAGGCAGCAGAGGCCGAGCTGCAGCTGCTGGC
CGCCGCCCAGCGCCCCCACCTGGGCGAGCAGCGCCTCAA
AGCTGAGGGGGCCTGGGGGCACGGCCAGCGACAGGCTGCTGCCCAGTCCGTCGCCGCCCGCGTCTCCCTCCCCCTCCCGC
TCGCGCTCCCGCTCACCCTGCAGCTGCTCCGTGGGCACCGCATCTCCGAGGGTCCCGACCTGCTGTTGGGGGGCAGGGGG
TGGCAGGAGAAGGGTGAAGCGGAGGAAACCGCAGAGCAAGGGCAGGGGGCAGGTGGGAGGGAGGGCTAGGAAGGCAGTCA
GGGGCGAGGGATGCGCAGGAGGAAAATGCCAGACGCTCCGCGGGGGCGGGGGTGCTGGGAGAGGATGGCGTCGCCACCTG
GGGCTCGGGCACTTACTCCGTTGGAGGTGGGGGTGATCTCTACAGTGTTGTCGATTTTGCCGCCGCCCCCGCCATTGGGC
TCGGGGGTCCCGGTGGCCACCCGGGGAGCCAGCTTGCCGACCGCAGGGGCCCTGCCGGCCCGCGCCGAAAGGATGCGCTG
TCCTCTGGCTCAGTTGC
GCGCCGGCTGCCCG
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: SLC22A17-P
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 1: Coding
4234
PDE
23821361 GRCh37
22891201 NCBI36
11963
GCTGCTCCCAGCCAGAGGCATTAGG G → A GGGAAGGCCCCGTAGTGGCAATGCA
+21
Pro = Pro
n=
G/G=
G/A=
A/A=
A=
120
55
5
0
0.042
134
65
2
0
0.015
134
60
5
2
0.067
130
62
3
0
0.023
PMT-272
Promoter
4239
PDE
23821649 GRCh37
22891489 NCBI36
-170-226
GCTCCGTGGGCACCGCATCTCCGAG G → A GTCCCGACCTGCTGTTGGGGGGCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
120
60
0
0
0.000
134
66
1
0
0.007
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
Promoter
5877
PDE
23821710 GRCh37
22891550 NCBI36
-231-287
GAGAAGGGTGAAGCGGAGGAAACCG C → T AGAGCAAGGGCAGGGGGCAGGTGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
120
59
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
Promoter
4240
PDE
23821719 GRCh37
22891559 NCBI36
-240-296
GAAGCGGAGGAAACCGCAGAGCAAG G → T GCAGGGGGCAGGTGGGAGGGAGGGC
+ 
 
n=
G/G=
G/T=
T/T=
T=
120
59
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272
 
5878
PDE
23821777 GRCh37
22891617 NCBI36
-298-354
GCAGTCAGGGGCGAGGGATGCGCAG G → A AGGAAAATGCCAGACGCTCCGCGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
120
60
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
130
64
1
0
0.008
PMT-272
 
5879
PDE
23821921 GRCh37
22891761 NCBI36
-442-498
TGCCGCCGCCCCCGCCATTGGGCTC G → A GGGGTCCCGGTGGCCACCCGGGGAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
120
60
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
130
65
0
0
0.000
PMT-272
 
4235
PDE
23821930 GRCh37
22891770 NCBI36
-451-507
CCCCGCCATTGGGCTCGGGGGTCCC G → A GTGGCCACCCGGGGAGCCAGCTTGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
120
59
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.