UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001043
NM_001172501
NM_001172504
NM_001172502
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001043 [Chr.16(+): 55690352-55737700 GRCh37]
Id:PROMOTER2
Position:Chr.16(+): 55690056-55690856 GRCh37
Chr.16(+): 54247557-54248357 NCBI36
Sequence:
CCAGGGATCCCCTCGCCGCCGGACACGTGAGTGCGCCCTGAGCGCGGGACAGGGCTAGGTCTGCCTGGGAGGCCCGGGCC
GAGACGCGCCAGCAGAGGGCTAGCGAGTTTGTAGTGCAGTGACGTTAAGTGTCCGAGAAGGCTCCTGTGGCTGTTGAAGT
GTCGCGGACCTGAGCTGGGGAGGGGGTCGGCACGCTGCCCTCAGCCTCGGTGAGTTCAATCCCAGCCATTTGGGGCAGGC
GAGAGTGGGTGAACGAGGAAAAGTGCTGCAGGGTCTTCAGCCGCCCCCAGAGGGCTGTCAGAAGTCTCCAACTCTTGAGT
TCCGGCGTGCCCCAACCTCTGTTTCCAAATTTTTCCAGCGG
ACGCGCGCCCTTTTCTGGGAACCCTGCGTCCGCTCAGCG
CGCGCTCATCCCAGTGTCTAAGGCGCTCCCGGGTGGTCTTGGGAGTTGCAAGTAGGGAGGAACGGCCGGGTAACCACCTC
TTTTCCCTTTA
TCCAAGCAGAGCCTCGGCGTGCCCCCAGGACCGGTAAAGTTCCTCTCGCCAGCCGCATCCATGCTTCTG
GCGCGGATGAACCCGCAGGTGCAGCCCGAGAACAACGGGGCGGACACGGGTCCAGAGCAGCCCCTTCGGGCGCGCAAAAC
TGCGGAGCTGCTGGTGGTGAAGGAGCGCAACGGCGTCCAGTGCCTGCTGGCGCCCCGCGACGGCGACGCGCAGCCCCGGG
AGACCTGGGGCAAGAAGATCGACTTCCTGCTGTCCGTAGTCGGCTTCGCAGTGGACCTGGCCAACGTGTGGCGCTTCCCC
T
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: PROMOTER2
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Promoter
5883
PDE
55690261 GRCh37
54247762 NCBI36
-91-346
AGGGGGTCGGCACGCTGCCCTCAGC C → T TCGGTGAGTTCAATCCCAGCCATTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
64
0
0
0.000
124
61
1
0
0.008
128
64
0
0
0.000
130
65
0
0
0.000
PMT-272
Promoter
5884
PDE
55690265 GRCh37
54247766 NCBI36
-87-342
GGTCGGCACGCTGCCCTCAGCCTCG G → A TGAGTTCAATCCCAGCCATTTGGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
64
0
0
0.000
124
62
0
0
0.000
128
64
0
0
0.000
130
64
1
0
0.008
PMT-272
Exon 1: 5UTR
5885
PDE
55690417 GRCh37
54247918 NCBI36
66-190
CTCTGTTTCCAAATTTTTCCAGCGG A → T CGCGCGCCCTTTTCTGGGAACCCTG
+ 
 
n=
A/A=
A/T=
T/T=
T=
128
60
4
0
0.031
124
62
0
0
0.000
128
64
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 1: 5UTR
5886
PDE
15 pubsI
55690425 GRCh37
54247926 NCBI36
74-182
CCAAATTTTTCCAGCGGACGCGCGC C → T CTTTTCTGGGAACCCTGCGTCCGCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
1
23
40
0.805
124
2
27
33
0.750
128
9
25
30
0.664
130
1
29
35
0.762
PMT-272
Exon 1: 5UTR
5887
PDE
55690447 GRCh37
54247948 NCBI36
96-160
CGCCCTTTTCTGGGAACCCTGCGTC C → G GCTCAGCGCGCGCTCATCCCAGTGT
+ 
 
n=
C/C=
C/G=
G/G=
G=
128
64
0
0
0.000
124
62
0
0
0.000
128
64
0
0
0.000
130
64
1
0
0.008
PMT-272
Exon 1: 5UTR
5888
PDE
55690547 GRCh37
54248048 NCBI36
196-60
CGGGTAACCACCTCTTTTCCCTTTA T → A CCAAGCAGAGCCTCGGCGTGCCCCC
+ 
 
n=
T/T=
T/A=
A/A=
A=
128
64
0
0
0.000
124
62
0
0
0.000
128
63
1
0
0.008
130
65
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.