UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:ABCB1-P SEQ
Position:Chr.7(+): 87342364-87343114 GRCh37
Chr.7(+): 87180300-87181050 NCBI36
Sequence:
AAGAAATTCTTAATTCTAATTAAATTTGATTGCAAACTTCTAGTCAAGACAAATATATTCATAAGATTAGATTTGTAAAA
TACAAACAATTAGAAAGAGTATTTGTACCTTACCTTTTATCTGGTTGCTTCCTGAAGTGAGTACTCCTAGGAGAATGAGA
AATGATCTCTAATCTTTAGGAATCTGGAGAATATCTGAATAAAGTAGATTTCTTCATGTTCT
ACTCTTCACAGGTAAAGA
GTAATGATAGCCTTTAAAATGGTAATACAAGTGTTT
ATCCCAGTACCAGAGGAGGAGCTACATGAACTAAGGCAGGCAGG
CTTGAAAGCACTAATCAGTGAAAACCCAAGGATAAGTTTGGGTGGAGGAAGGGTGGGAGTAGAGATAAAATAAATTTTGA
GTACATGACTATGGCTCCAAAGCATTGAAGAAATATGTGTGATCTTTTTGCTAAGGTGTAGGACGTCTTAATGAGCAGTT
GAAAAAACAAACAAAAACCTCGAAGAGTTACATGGCTTAGGGATTGGGGTATAATTGAAAAATAGCCAGAGTTGAGAAGT
TTAGCCAGAATAGGCAGAATGAAGATTAGAATCTAAGCTAAAAAAAAAAAAAAAAAAGAGAGAGACTTCTTTTGGTAGGT
TACTGGGAAGACCTTCAAATGAGAAGTGAAGTAAAAATTGAATTAATTTGTTCAAATTTTTAATTTCTCTTTATCCACTG
GCTAAAAAATAATTAGTAAATTTCAATTTAA
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: ABCB1-P
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 1: 5UTR
4164
PDE
87342586 GRCh37
87180522 NCBI36
54-113086
AATAAAGTAGATTTCTTCATGTTCT A → G CTCTTCACAGGTAAAGAGTAATGAT
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
65
0
0
0.000
92
46
0
0
0.000
130
58
7
0
0.054
126
61
2
0
0.016
PMT-272
Promoter
4165
PDE
1 pubI
87342766 GRCh37
87180702 NCBI36
-127-113266
AGTAGAGATAAAATAAATTTTGAGT A → G CATGACTATGGCTCCAAAGCATTGA
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
56
9
0
0.069
92
42
4
0
0.043
130
56
8
1
0.077
126
56
7
0
0.056
PMT-272
Promoter
4166
PDE
87342850 GRCh37
87180786 NCBI36
-211-113350
GACGTCTTAATGAGCAGTTGAAAAA A → - CAAACAAAAACCTCGAAGAGTTACA
+ 
 
n=
A/A=
A/-=
-/-=
-=
130
65
0
0
0.000
92
46
0
0
0.000
130
64
1
0
0.008
126
63
0
0
0.000
PMT-272
 
4167
PDE
87342899 GRCh37
87180835 NCBI36
-260-113399
CATGGCTTAGGGATTGGGGTATAAT T → G GAAAAATAGCCAGAGTTGAGAAGTT
+ 
 
n=
T/T=
T/G=
G/G=
G=
130
65
0
0
0.000
92
46
0
0
0.000
128
57
7
0
0.055
126
61
2
0
0.016
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.