UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000392
XM_005269536
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000392 [Chr.10(+): 101542463-101611662 GRCh37]
Id:ABCC2_exon2
Position:Chr.10(+): 101544278-101544619 GRCh37
Chr.10(+): 101534268-101534609 NCBI36
Sequence:
TTGTGTGAAAGCAGTGGGATGTGCTGCAGGGTGGTTTTCTGTCTTCACAATGCATGTATGCAACAATCCTTCCCCTTTGG
TCTCCAGAATTCCTCATTCCTGGACAGTCCGGAGGCAGACCTGCCACTTTGTTTTGAGCAAACTGTTCTGGTGTGGATTC
CCTTGGGCT
TCCTATGGCTCCTGGCCCCCTGGCAGCTTCTCCACGTGTATAAATCCAGGACCAAGAGATCCTCTACCACC
AAACTCTATCTTGCTAAGCAG
GTAAAGTTAACACCACTGTTTCTGAACTCTAATTCCTTGGTGCACAGTAGAGACATTTT
CTTGGT
GGTTAGTGTTCTCTTC
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: ABCC2_2_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4330
PDE
101544357 GRCh37
101534347 NCBI36
  
TGTATGCAACAATCCTTCCCCTTTG G → A TCTCCAGAATTCCTCATTCCTGGAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
97
2
1
0.020
200
100
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: Coding
4331
PDE
I
101544447 GRCh37
101534437 NCBI36
255116
GTTCTGGTGTGGATTCCCTTGGGCT T → A CCTATGGCTCCTGGCCCCCTGGCAG
+39
Phe → Tyr
(D=22)
n=
T/T=
T/A=
A/A=
A=
200
96
4
0
0.020
200
100
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: Coding
4332
PDE
101544490 GRCh37
101534480 NCBI36
298159
CCTGGCAGCTTCTCCACGTGTATAA A → G TCCAGGACCAAGAGATCCTCTACCA
+53
Lys = Lys
n=
A/A=
A/G=
G/G=
G=
200
98
2
0
0.010
200
98
2
0
0.010
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.