UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000492
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000492 [Chr.7(+): 117120017-117308719 GRCh37]
Id:ABCC7-P SEQ
Position:Chr.7(+): 117119417-117120167 GRCh37
Chr.7(+): 116906653-116907403 NCBI36
Sequence:
ACACTGCCGCGGAACTTTTCGGCTCTCTAAGGCTGTATTTTGATATACGAAAGGCACATTTTCCTTCCCTTTTCAAAATG
CACCTTGCAAACGTAACAGGAACCCGACTAGGATCATCGGGAAAAGGAGGAGGAGGAGGAAGGCAGGCTCCGGGGAAGCT
GGTGGCAGCGGGTCCTGGGTCTGGCGGACCCTGACGCGAAGGAGGGTCTAGGAAGCTCTCCGGGGAGCCGGTTCTCCCGC
CGGTGGCTTCTTCTGTCCTCCAGCGTTGCCAACTGGACCTAAAGAGAGGCCGCGACTGTCGCCCACCTGCGGGATGGGCC
TGGTGCTGGGCGGTAAGGACACGGACCTGGAAGGAGCGCGCGCGAGGGAGGGAGGCTGGGAGTCAGAATCGGGAAAGGGA
GGTGCGGGGCGGCGAGGGAGCGAAGGAGGAGAGGAGGAAGGAGCGGGAGGGGTGCTGGCGGGGGTGCGTAGTGGGTGGAG
AAAGCCGCTAGAGCAAATTTGGGGCCGGACCAGGCAGCACTCGGCTTTTAACCTGGGCAGTGAAGGCGGGGGAAAGAGCA
AAAGGAAGGGGTGGTGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAG
GGTTGAGCGGCAGGCACCCAGAGTAGTAGGTCTTTGG
CATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGC
GCCCGAGAGACC
ATGCAGAGGTCGCCTCTGG
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: ABCC7-P
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Promoter
4200
PDE
117119861 GRCh37
116907097 NCBI36
-156-288
GCGAAGGAGGAGAGGAGGAAGGAGC G → C GGAGGGGTGCTGGCGGGGGTGCGTA
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
64
2
0
0.015
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Promoter
4201
PDE
117119866 GRCh37
116907102 NCBI36
-151-283
GGAGGAGAGGAGGAAGGAGCGGGAG G → A GGTGCTGGCGGGGGTGCGTAGTGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
PMT-272
Promoter
4202
PDE
117119875 GRCh37
116907111 NCBI36
-142-274
GAGGAAGGAGCGGGAGGGGTGCTGG C → A GGGGGTGCGTAGTGGGTGGAGAAAG
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
65
1
0
0.008
134
66
1
0
0.007
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Promoter
4203
PDE
117119923 GRCh37
116907159 NCBI36
-94-226
AAGCCGCTAGAGCAAATTTGGGGCC G → T GACCAGGCAGCACTCGGCTTTTAAC
+ 
 
n=
G/G=
G/T=
T/T=
T=
132
63
3
0
0.023
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Promoter
4204
PDE
117119984 GRCh37
116907220 NCBI36
-33-165
AAGGCGGGGGAAAGAGCAAAAGGAA G → A GGGTGGTGTGCGGAGTAGGGGTGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.