UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_021082
NM_001145998
XM_005247722
XM_005247723
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_021082 [Chr.3(+): 121613171-121663034 GRCh37]
Id:SLC15A2_exon12
Position:Chr.3(+): 121643145-121643378 GRCh37
Chr.3(+): 123125835-123126068 NCBI36
Sequence:
TTTTTTTTCTTTTCTTCAGACATCAACTAAATTAATTTGTTAAAATGTTTCAGGGGTTTTTTGTGCTTCAGCCGGACCAG
ATGCAG
GTATGTGACTCTTCTATAGCCATGGGGACTTATTTGTTTCCTTATCTATGCCTCCACCTGCAGTATTACGATTA
ACAACCATAATTTGATGCTTTTCTCCTTGTACGCTGATAAGGGCCAAGCTTCGACATGAAAACATTCTCATTAA
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC15A2_12_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 
4354
PDE
121643170 GRCh37
123125860 NCBI36
  
TTTTTTTTCTTTTCTTCAGACATCA A → T CTAAATTAATTTGTTAAAATGTTTC
+ 
 
n=
A/A=
A/T=
T/T=
T=
200
20
53
27
0.535
198
26
49
24
0.490
60
4
15
11
0.617
20
7
0
3
0.300
14
3
4
0
0.286
Set-I
 
4355
PDE
121643299 GRCh37
123125989 NCBI36
  
ATCTATGCCTCCACCTGCAGTATTA C → A GATTAACAACCATAATTTGATGCTT
+ 
 
n=
C/C=
C/A=
A/A=
A=
200
100
0
0
0.000
198
99
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
4356
PDE
A
121643303 GRCh37
123125993 NCBI36
  
ATGCCTCCACCTGCAGTATTACGAT T → A AACAACCATAATTTGATGCTTTTCT
+ 
 
n=
T/T=
T/A=
A/A=
A=
200
20
53
27
0.535
198
27
49
23
0.480
60
4
15
11
0.617
20
7
0
3
0.300
14
3
4
0
0.286
Set-I
 
4357
PDE
A
121643337 GRCh37
123126027 NCBI36
  
TAATTTGATGCTTTTCTCCTTGTAC G → A CTGATAAGGGCCAAGCTTCGACATG
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
20
53
27
0.535
198
27
49
23
0.480
60
4
15
11
0.617
20
7
0
3
0.300
14
3
4
0
0.286
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.