UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001043
NM_001172501
NM_001172504
NM_001172502
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001043 [Chr.16(+): 55690352-55737700 GRCh37]
Id:SLC6A2_exon5
Position:Chr.16(+): 55725702-55726103 GRCh37
Chr.16(+): 54283203-54283604 NCBI36
Sequence:
TGTGCTTTGGGTAAAGGAAGGTGGGAAAGAGCATGACTGGCTCCCTGGGAAAGGGCTCTGTGCCCCACCAGCCCGCCACG
GGATTGGGGCCAGAGCGAGGCTCTCACCTGAACTTATCCATTGCCCAGGTGGTGTGGATCACAGCCACGCTGCCTTACTT
CGTGCTGTTCGTGCTCCTGGTCCATGGCGTCA
CGCTGCCCGGAGCCTCCAATGGCATCAATGCCTACCTGCACATCGACT
TCTACCGCTTGAAAGAGGCCACG
GTCAGTGCTCGGTGACCACCAAGCCTTGGGCCAGGCTTGTGGGAGGGTTTTCAGGAG
AAGGTGATGATGGAAAATCTGGTCCCAGCTCTGCCACAAATGTGCAGTGTAGCCTTGGACAGGATCCTTCCCTGTCTGAG
GT
Color Legend: SNP  UTR  CODING
Sample Sets: Set-I
Assays: SLC6A2_5_PCR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 5: Coding
4333
PDE
1 pub
55725894 GRCh37
54283395 NCBI36
1103848
TTCGTGCTCCTGGTCCATGGCGTCA C → G GCTGCCCGGAGCCTCCAATGGCATC
+283
Thr → Arg
(D=71)
n=
C/C=
C/G=
G/G=
G=
192
95
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 
4334
PDE
IA
55725975 GRCh37
54283476 NCBI36
  
TTGAAAGAGGCCACGGTCAGTGCTC G → A GTGACCACCAAGCCTTGGGCCAGGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
192
0
3
93
0.984
192
1
16
79
0.906
60
0
10
20
0.833
20
0
1
9
0.950
14
0
0
7
1.000
Set-I
 
4335
PDE
55726047 GRCh37
54283548 NCBI36
  
AAGGTGATGATGGAAAATCTGGTCC C → T AGCTCTGCCACAAATGTGCAGTGTA
+ 
 
n=
C/C=
C/T=
T/T=
T=
192
95
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 
4336
PDE
2 pubs
55726058 GRCh37
54283559 NCBI36
  
GGAAAATCTGGTCCCAGCTCTGCCA C → T AAATGTGCAGTGTAGCCTTGGACAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
192
96
0
0
0.000
192
92
4
0
0.021
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.