UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_033125
XM_005267183
XM_005267184
XM_005267185
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_033125 [Chr.6(-): 110745890-110797844 GRCh37]
Id:Exon 3
Position:Chr.6(+): 110767848-110768393 GRCh37
Chr.6(+): 110874541-110875086 NCBI36
Sequence:
CGACACAGAGGCAAACACACTTCTGCCTAGCCAGCAACAATTTTTCACTTTAATGAGTTCCATTCTAAACATAAGGCATT
GGTATTCTGTAGGCAGACTTCTGCAGTGGAGTGGACAAAGATGAGTCCTTGATCTCGCTCACTAGATCTTAAATGAGCAA
AATGATGAGAGTTAAGGTTTCCTATGAAAAACTGCAGCAGAATTAAAGAAGTAAAAAACACAACTCACCATGGCAAGAAA
AAAGCGAGCAGCCATGAAGGTGTAATAATCAACTGCAAAC
GCCGCTGCTATTCCAAACAAAAACATGCTACTGCTTGTGG
CCCACAAGACCACCCGGCGTCCTAGC
CTGAAAAATAAGAGTCACACAGTGGAAGAGGAAAGGTAGAGTTGTAACAGTTTA
AACATCCACTCCAATTCATAAAAGATAGGCATTACCTATATACCTTGAATAGCTTATGTATTGATTGTTTTTCTTTTATT
TATTTTGAGCAAACCATAAGTTCCATGGCTTCTTTAAAAGACCAGCTGTTCAGTGGAGAGGCCTTT
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: Exon 3
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
5955
PDE
110767960 GRCh37
110874653 NCBI36
  
TGTAGGCAGACTTCTGCAGTGGAGT G → A GACAAAGATGAGTCCTTGATCTCGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
128
64
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 3: Coding
5956
PDE
110768128 GRCh37
110874821 NCBI36
666599
GAAGGTGTAATAATCAACTGCAAAC G → A CCGCTGCTATTCCAAACAAAAACAT
+200
Ala → Val
(D=64)
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
128
64
0
0
0.000
136
68
0
0
0.000
134
64
3
0
0.022
PMT-272
Exon 3: Coding
5957
PDE
110768130 GRCh37
110874823 NCBI36
664597
AGGTGTAATAATCAACTGCAAACGC C → T GCTGCTATTCCAAACAAAAACATGC
+199
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
128
64
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
 
5958
PDE
110768231 GRCh37
110874924 NCBI36
  
AGTCACACAGTGGAAGAGGAAAGGT A → AA GAGTTGTAACAGTTTAAACATCCAC
+ 
 
n=
A/A=
A/AA=
AA/AA=
AA=
130
65
0
0
0.000
128
64
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.