UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_033125
XM_005267183
XM_005267184
XM_005267185
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_033125 [Chr.6(-): 110745890-110797844 GRCh37]
Id:Exon 4
Position:Chr.6(+): 110763227-110764047 GRCh37
Chr.6(+): 110869920-110870740 NCBI36
Sequence:
GCCATTTTTCCATGAACTGGTTGAAGTCCCCTCATATGTACATGTGTTACAACATAACACTAAGAGATATCATAATAATA
TGGTTGGCAGTATTGTTCCTGGTTTTAAAGGGCCTATTAAAAACATTCTTTTTCTCAAATTCACACAGAAACAGACACAC
ACACACAAATGGTAGAAATCTCACTTCACTGCCAAATTTAAATATACTGTAACTACTTACCCAGGAGGAAGAGGTTTAAG
TATTCATTGCCTCCTAAGTTAACAGAATTCAAGGAAAAC
GAGTAGAATCCCAAACTTCCAGTGAACCAGATTAGCCAAAC
GGTAAGTGTCCTTTTCGTAATGCTCCAGTTATAAAACAGATATGATAGGTTGTGCTTCTGAACTTCAGTGGGGCTATTAC
TAACAGGACCTTGTAGGTCCAGTGATAAAAGTTCTGACAGTTTACAGGAGCTTGCCCTGTTCCACTTGGCCATGATGTCA
ACTATTTTTTGTGCTTCTTCATATCGTCCCTCTGA
GAGAAGCCAAAAAGGTGTCTCTGGGAGCACCCAACAGCACAGGAT
AAAGGGGACAGTCACTGTGGAGAG
GATCATCTGGTAAAGCCACCAGGTCCTGACCAAGTATCCTGTCAAAGCCACCAGCA
GGGTTCCA
ACTGCAAAAAAGGAATGCAAATGGACAGACGCCCATGTCCGAGACTTCATGCCAATGAATTCCATCACATAG
ACAAACCCCACCACAAGATAGCCACTTGCAAC
CTGAAAAACAAATAATAGGGATTTATATTCAAGGTCACATTTATAACT
ATTGAGGAGTCTGACCCCATT
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: Exon 4
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
5959
PDE
110763410 GRCh37
110870103 NCBI36
  
ACACACACAAATGGTAGAAATCTCA C → A TTCACTGCCAAATTTAAATATACTG
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
63
3
0
0.023
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 4: Coding
5960
PDE
110763506 GRCh37
110870199 NCBI36
11911124
TAAGTTAACAGAATTCAAGGAAAAC G → A AGTAGAATCCCAAACTTCCAGTGAA
+375
Ser → Leu
(D=145)
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 4: Coding
5961
PDE
110763547 GRCh37
110870240 NCBI36
11501083
TTCCAGTGAACCAGATTAGCCAAAC G → A GTAAGTGTCCTTTTCGTAATGCTCC
+361
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
132
62
3
1
0.038
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 4: Coding
5962
PDE
110763742 GRCh37
110870435 NCBI36
955888
GTGCTTCTTCATATCGTCCCTCTGA G → C AGAAGCCAAAAAGGTGTCTCTGGGA
+296
Leu = Leu
n=
G/G=
G/C=
C/C=
C=
132
65
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 4: Coding
5963
PDE
110763811 GRCh37
110870504 NCBI36
886819
TAAAGGGGACAGTCACTGTGGAGAG G → A ATCATCTGGTAAAGCCACCAGGTCC
+273
Ile = Ile
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 4: Coding
5964
PDE
1 pubI
110763875 GRCh37
110870568 NCBI36
822755
TGTCAAAGCCACCAGCAGGGTTCCA A → G CTGCAAAAAAGGAATGCAAATGGAC
+252
Val → Ala
(D=64)
n=
A/A=
A/G=
G/G=
G=
132
52
13
1
0.114
134
56
11
0
0.082
136
59
9
0
0.066
132
52
13
1
0.114
PMT-272
Exon 4: Coding
5965
PDE
110763910 GRCh37
110870603 NCBI36
787720
AGGAATGCAAATGGACAGACGCCCA T → C GTCCGAGACTTCATGCCAATGAATT
+240
Thr = Thr
n=
T/T=
T/C=
C/C=
C=
132
66
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
PMT-272
Exon 4: Coding
5966
PDE
110763935 GRCh37
110870628 NCBI36
762695
TGTCCGAGACTTCATGCCAATGAAT T → C CCATCACATAGACAAACCCCACCAC
+232
Glu → Gly
(D=98)
n=
T/T=
T/C=
C/C=
C=
132
65
1
0
0.008
134
64
3
0
0.022
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.