UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_033125
XM_005267183
XM_005267184
XM_005267185
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_033125 [Chr.6(-): 110745890-110797844 GRCh37]
Id:Exon 2
Position:Chr.6(+): 110777507-110778439 GRCh37
Chr.6(+): 110884200-110885132 NCBI36
Sequence:
GCCTGGGGTCCACAGTTAATAAGTGGTAGAACCAGGATTTGGATCTAGGTATACTGTCTTCAGAGCCTATCCTTATCATT
ATACATCCCTAAATAATGGATCAGCAAAGAGGTAGGTATTTAGATAGGAAGTATAAAAATGACAAGTTTTAAACATAATT
CCTTGTGTCCCAAGAAAACCAGATAGGAAAATAAACCCTACACTGATACAACAATCCTAAATATTTGATTTTACCTGTCA
GAAAAGTAGCCAAAAGTCAC
CGATCCCAGTAGGACTCCAAACATAAATAGGGGCTGGATCAGCATTGCAAGCCATTTTCG
GTCACAGACCAGGTTCCACTGGGTCACCGCAGTGCTTTTCCATGTGTTCTGGTCATATATGTAGCCATCCACACAAGGAA
ACTCTTTCTTACTGCCAGTGTATTCATAGCCCAAACTCGATGTGTTCTCCCTCTT
ATTCCTGCTACACCTTGAGAGCTCC
CAGATCTCACCATTCTGCAACTGCACCGTAACATAATCTTTCTGGCCTGAAGACAACAGGGCCCCGGTGTCCT
CCAAACT
CCAATTAGAGTGATTATGGAAAACAACCTGACTCACATTGCCTGGGGGCCTGCAGACATGA
TGAGGGGTGACTCCCATGA
ACACAGAAGCCAAGTAGTGAATACCACAAGAGATGTTCTGGAAGGCACATATGAAATAGAGGACTCTCTGGAAT
CTGCAA
GAGAAGAAAAGCTAATTATTATATCTGGTCTATAGGCTGAAAAAGAACATAAGCAAATTTGAAGGGTCTCCATCATGTTT
ATCTTAACATATACACGAATGGATAAATATAGAAATAATTATAGACATATTTATATCTGTGGGTTAGTATATATACATAT
ATTACTTAGCTCCATCTACTGAGAAGGCCTAGAAGCAATGACATCCCAAGAGC
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: Exon 2
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
5975
PDE
110777561 GRCh37
110884254 NCBI36
  
AACCAGGATTTGGATCTAGGTATAC T → A GTCTTCAGAGCCTATCCTTATCATT
+ 
 
n=
T/T=
T/A=
A/A=
A=
130
46
17
2
0.162
132
60
6
0
0.045
136
68
0
0
0.000
130
60
5
0
0.038
PMT-272
 
5976
PDE
110777605 GRCh37
110884298 NCBI36
  
TATCATTATACATCCCTAAATAATG G → A ATCAGCAAAGAGGTAGGTATTTAGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
63
2
0
0.015
132
66
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 
5977
PDE
110777618 GRCh37
110884311 NCBI36
  
CCCTAAATAATGGATCAGCAAAGAG G → C TAGGTATTTAGATAGGAAGTATAAA
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272
Exon 2: Coding
5978
PDE
110777767 GRCh37
110884460 NCBI36
574507
TGTCAGAAAAGTAGCCAAAAGTCAC C → T GATCCCAGTAGGACTCCAAACATAA
+169
Ser = Ser
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272
Exon 2: Coding
5979
PDE
1 pubI
110777962 GRCh37
110884655 NCBI36
379312
CCAAACTCGATGTGTTCTCCCTCTT A → G TTCCTGCTACACCTTGAGAGCTCCC
+104
Asn = Asn
n=
A/A=
A/G=
G/G=
G=
130
23
30
12
0.415
132
31
30
5
0.303
136
32
28
8
0.324
130
45
18
2
0.169
PMT-272
Exon 2: Coding
5980
PDE
110778060 GRCh37
110884753 NCBI36
281214
GAAGACAACAGGGCCCCGGTGTCCT C → G CAAACTCCAATTAGAGTGATTATGG
+72
Glu → Gln
(D=29)
n=
C/C=
C/G=
G/G=
G=
130
65
0
0
0.000
132
66
0
0
0.000
136
65
3
0
0.022
130
65
0
0
0.000
PMT-272
Exon 2: Coding
5981
PDE
1 pubI
110778128 GRCh37
110884821 NCBI36
213146
ATTGCCTGGGGGCCTGCAGACATGA T → C GAGGGGTGACTCCCATGAACACAGA
+49
His → Arg
(D=29)
n=
T/T=
T/C=
C/C=
C=
130
23
30
12
0.415
132
31
30
5
0.303
136
32
28
8
0.324
130
45
18
2
0.169
PMT-272
 
5982
PDE
110778248 GRCh37
110884941 NCBI36
  
GCAAGAGAAGAAAAGCTAATTATTA T → C ATCTGGTCTATAGGCTGAAAAAGAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272
 
5983
PDE
110778326 GRCh37
110885019 NCBI36
  
ATGTTTATCTTAACATATACACGAA T → C GGATAAATATAGAAATAATTATAGA
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
64
1
0
0.008
132
66
0
0
0.000
136
62
6
0
0.044
130
65
0
0
0.000
PMT-272
 
5984
PDE
110778376 GRCh37
110885069 NCBI36
  
ACATATTTATATCTGTGGGTTAGTA T → C ATATACATATATTACTTAGCTCCAT
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.