UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_033125
XM_005267183
XM_005267184
XM_005267185
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_033125 [Chr.6(-): 110745890-110797844 GRCh37]
Id:Exon 5
Position:Chr.6(+): 110759679-110760255 GRCh37
Chr.6(+): 110866372-110866948 NCBI36
Sequence:
GTCATTGCACCCAGGTTAGGCTTTTCTTTTTTTTTTACATTTTTCTCTTCAAATTTTCTAAAATGAACATATATTACTTA
TATAACAGAAAAAGAATGTTTTAAAGAAAACAGATTTTTAAATATTATATACTCTGCCCAAATCATACTCTGAATTGACC
TTCATACTTAACTGTAATAAGCTAAATTCTTCCCATCAAACTGTCACAGTATAACTGTCTTATAAAAAACAGAAGATAAC
TCACCTGGGGGATCACCATAACGACACCACAGGCCAGTGCACTGCAGAAAAGAGAGTAGGCCAGGACTGTTCTCCTCCCG
ACCTTGTCC
ATGGCGATGCACACGAAGGTGTAGGCGGGAATTTCCACTACACCTGTCATTGAGCAAGCAGCCCTCTATAA
GTCTAGGTACCCGACTGCAAAAGGGGACCCCCGTCTTCTAACCCACTACCCAAAAGGCATGAGCAGCCCTCTCCTCACTT
CTGGGGCCTTTAGAAACTCTCTAAGAATTGCTGCGAGGCAGCCAGCCCCGCCACTTTTAAACTCACTACAGTAAAGATGA
GCGTTTCCTGTGAAATG
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: Exon 5
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
5985
PDE
110759743 GRCh37
110866436 NCBI36
  
TTTTTCTCTTCAAATTTTCTAAAAT G → A AACATATATTACTTATATAACAGAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
130
65
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
 
5986
PDE
110759758 GRCh37
110866451 NCBI36
  
TTTCTAAAATGAACATATATTACTT ATATAAC → - AGAAAAAGAATGTTTTAAA
+ 
 
n=
ATATAAC/ATATAAC=
ATATAAC/-=
-/-=
-=
132
65
1
0
0.008
130
52
11
2
0.115
134
63
4
0
0.030
134
67
0
0
0.000
PMT-272
 
5987
PDE
110759815 GRCh37
110866508 NCBI36
  
AGATTTTTAAATATTATATACTCTG C → T CCAAATCATACTCTGAATTGACCTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
63
3
0
0.023
130
65
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
 
5988
PDE
110759826 GRCh37
110866519 NCBI36
  
TATTATATACTCTGCCCAAATCATA C → T TCTGAATTGACCTTCATACTTAACT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
48
17
1
0.144
130
60
5
0
0.038
134
67
0
0
0.000
134
63
4
0
0.030
PMT-272
 
5989
PDE
110759904 GRCh37
110866597 NCBI36
  
CTGTCACAGTATAACTGTCTTATAA A → G AAACAGAAGATAACTCACCTGGGGG
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
64
2
0
0.015
130
65
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 5: Coding
5990
PDE
110759940 GRCh37
110866633 NCBI36
13611294
TAACTCACCTGGGGGATCACCATAA C → T GACACCACAGGCCAGTGCACTGCAG
+432
Val → Ile
(D=29)
n=
C/C=
C/T=
T/T=
T=
132
63
3
0
0.023
130
65
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 5: Coding
5991
PDE
110759943 GRCh37
110866636 NCBI36
13581291
CTCACCTGGGGGATCACCATAACGA C → T ACCACAGGCCAGTGCACTGCAGAAA
+431
Val → Ile
(D=29)
n=
C/C=
C/T=
T/T=
T=
132
62
4
0
0.030
130
65
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 5: Coding
5992
PDE
110759957 GRCh37
110866650 NCBI36
13441277
CACCATAACGACACCACAGGCCAGT G → T CACTGCAGAAAAGAGAGTAGGCCAG
+426
Ala → Glu
(D=107)
n=
G/G=
G/T=
T/T=
T=
132
66
0
0
0.000
130
65
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 5: Coding
5993
PDE
1 pubI
110760008 GRCh37
110866701 NCBI36
12931226
GACTGTTCTCCTCCCGACCTTGTCC A → G TGGCGATGCACACGAAGGTGTAGGC
+409
Met → Thr
(D=81)
n=
A/A=
A/G=
G/G=
G=
132
57
9
0
0.068
130
41
21
3
0.208
134
67
0
0
0.000
134
44
20
3
0.194
PMT-272
 
5994
PDE
110760199 GRCh37
110866892 NCBI36
  
ACTCTCTAAGAATTGCTGCGAGGCA G → A CCAGCCCCGCCACTTTTAAACTCAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
63
3
0
0.023
130
65
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.