UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_033125
XM_005267183
XM_005267184
XM_005267185
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_033125 [Chr.6(-): 110745890-110797844 GRCh37]
Id:Exon 6
Position:Chr.6(+): 110756777-110757359 GRCh37
Chr.6(+): 110863470-110864052 NCBI36
Sequence:
TTGAGTCAATACAGAGACTCAGTGGAAGTCTATGGTACTTGAAACTTAAAATGTTTTTGGAATAATAGAGTGTTATTTCA
AAATAATTCGTCTAATATCCTCACTAATAGGGTACAAAGCCTCAGACTCAAAATGAGTATCAGCATGTCATTTTCCCATC
TCAGAGATCCAGGTAACTTCTATAAAAAAGAAGCATTTACATGTAAAGGCCAAATACAATGAAATGACACACAAGTGAAA
GATAATAGGAAAACAACCAGAAAACAATTCATCCTTACCTTACAATGGTTGGATACAGCTCAGCTGTATAAAGATAAATG
AGGCCAAATGCTGCCCC
GATGGCAAATTTTCCAACCATAGCTGTCACCACACCCAAAATATAATGTTTCTGAAAAAAATT
TAGCAGAATAGATCATCACAAGTGGTATTTTTAAAGGAAAATAGAAAATCTTTAAAATCATTACTTAAAACATTCTAATT
CCTTCAGTATTTTTTCAGAACAATGAAGACCCTTATTTTTCTGTTTGAATGTATTAAACTCTACTCACAGTCTGAGAAAG
CTTTCCATCTTTACGAAATGTGG
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: Exon 6
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
5995
PDE
I
110756960 GRCh37
110863653 NCBI36
  
TCTCAGAGATCCAGGTAACTTCTAT A → G AAAAAGAAGCATTTACATGTAAAGG
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
9
33
24
0.614
134
27
32
8
0.358
136
33
27
8
0.316
136
45
19
4
0.199
PMT-272
 
5996
PDE
110756974 GRCh37
110863667 NCBI36
  
GTAACTTCTATAAAAAAGAAGCATT T → C ACATGTAAAGGCCAAATACAATGAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
66
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
 
5997
PDE
IA
110757008 GRCh37
110863701 NCBI36
  
AGGCCAAATACAATGAAATGACACA C → A AAGTGAAAGATAATAGGAAAACAAC
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
46
18
2
0.167
134
49
12
6
0.179
136
64
4
0
0.029
136
64
4
0
0.029
PMT-272
Exon 6: Coding
5998
PDE
110757114 GRCh37
110863807 NCBI36
14291362
GATAAATGAGGCCAAATGCTGCCCC G → T ATGGCAAATTTTCCAACCATAGCTG
+454
Ile = Ile
n=
G/G=
G/T=
T/T=
T=
132
66
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 6: Coding
5999
PDE
110757132 GRCh37
110863825 NCBI36
14111344
CTGCCCCGATGGCAAATTTTCCAAC C → T ATAGCTGTCACCACACCCAAAATAT
+448
Met → Ile
(D=10)
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 6: Coding
6000
PDE
110757156 GRCh37
110863849 NCBI36
13871320
CCATAGCTGTCACCACACCCAAAAT A → G TAATGTTTCTGAAAAAAATTTAGCA
+440
Tyr = Tyr
n=
A/A=
A/G=
G/G=
G=
132
64
2
0
0.015
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 
6001
PDE
110757183 GRCh37
110863876 NCBI36
  
AATGTTTCTGAAAAAAATTTAGCAG A → C ATAGATCATCACAAGTGGTATTTTT
+ 
 
n=
A/A=
A/C=
C/C=
C=
132
65
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
 
6002
PDE
110757201 GRCh37
110863894 NCBI36
  
TTAGCAGAATAGATCATCACAAGTG G → C TATTTTTAAAGGAAAATAGAAAATC
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
65
1
0
0.008
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 
6003
PDE
110757216 GRCh37
110863909 NCBI36
  
ATCACAAGTGGTATTTTTAAAGGAA A → G ATAGAAAATCTTTAAAATCATTACT
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
64
1
1
0.023
134
52
12
3
0.134
136
64
4
0
0.029
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.