UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_033125
XM_005267183
XM_005267184
XM_005267185
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_033125 [Chr.6(-): 110745890-110797844 GRCh37]
Id:3'UTRa
Position:Chr.6(+): 110745866-110746288 GRCh37
Chr.6(+): 110852559-110852981 NCBI36
Sequence:
TATTTTGCAGCAATAAGAAAGCAGTTTTTAAAACTGAGAATTTTCATCTTAGTTTTTATTTCTTTTATAACATATTTGCT
TTAAAATTTTCTTACAAAATTTATT
AAAAAGACATACAAACAACATATGGGAGATGAGAATAAGATTCCTCTAATACAAA
GGCATTAGGGTAAATAATATTTCAGGTGCTAGACAGCAGGCATGGCACAT
TTATTCACCAAGACCAGAATCCCTGGGGGT
AA
TCGCTTCCGTTTTTTCCAGCCCACTATTATTAGTTGTGAGAAGTAATTTGCTTGACTTGCTTTCATTCTCTGACTCCA
GTTTTGCAGCCTCCTCCCAAGTAGTTGCTAGCCGTTTCCCAAGGGTTTCTGGAAGCTTTAGTGTTAACACTCC
ACTCAGG
AGGGCCATAGTCC
CAACAAACAA
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTRa
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 8: 3UTR
6004
PDE
110745971 GRCh37
110852664 NCBI36
1906 
TTAAAATTTTCTTACAAAATTTATT A → T AAAAGACATACAAACAACATATGGG
+ 
 
n=
A/A=
A/T=
T/T=
T=
132
66
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
136
66
2
0
0.015
PMT-272
Exon 8: 3UTR
6005
PDE
110745977 GRCh37
110852670 NCBI36
1900 
TTTTCTTACAAAATTTATTAAAAAG A → T CATACAAACAACATATGGGAGATGA
+ 
 
n=
A/A=
A/T=
T/T=
T=
132
48
16
2
0.152
132
39
24
3
0.227
136
28
26
14
0.397
136
30
32
6
0.324
PMT-272
Exon 8: Coding
6006
PDE
110746108 GRCh37
110852801 NCBI36
17691702
CCAAGACCAGAATCCCTGGGGGTAA T → A CGCTTCCGTTTTTTCCAGCCCACTA
+568
Ile → Phe
(D=21)
n=
T/T=
T/A=
A/A=
A=
132
66
0
0
0.000
132
65
1
0
0.008
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 8: Coding
6007
PDE
110746146 GRCh37
110852839 NCBI36
17311664
TTCCAGCCCACTATTATTAGTTGTG A → G GAAGTAATTTGCTTGACTTGCTTTC
+555
Leu → Pro
(D=98)
n=
A/A=
A/G=
G/G=
G=
132
60
6
0
0.045
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.