UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_033125
XM_005267183
XM_005267184
XM_005267185
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_033125 [Chr.6(-): 110745890-110797844 GRCh37]
Id:Exon 7
Position:Chr.6(+): 110752229-110752779 GRCh37
Chr.6(+): 110858922-110859472 NCBI36
Sequence:
AGCTGTTGGTAATGGGGTTGTTTCTACAAACCCCATTAGGAAATGATGTACTGGCTTTCAGTAAATAACAATAGAGAAGT
TGCTAATAGGCAATTAGAAACTGCCTCCGTGCCCCCTTGGGGAGGGTCTGCAAACTGAAGCACACCTGTGGTATGAAGAT
CCAAATGCTGCTGAGGTCCACAGAGAACGG
CGCCAGGATGCTGGCCAGGCGACACACCATGCTGCCGCTTCCCACAGCCA
GCGAT
CTGGAAACAGAGGAGAGAGGCTGAGACAAGTAAGGCACAAGTGACCCAGGGATTGAGGGACCTGCTTCCTGCAGC
TCCTTTCCCACGCTCCCCAGCAAGGATAAGGGTGGTCAGGCAGCGCATTACAACGTTTCAGTCAACCTCGGTGGCCCCGC
GAGATTATAATAGCACATTTTTACTCGACTTTTTCTATCTTTCAATATGTTTAGATACACAAATATTTACCATTGTGTTA
CGACTGCCTGCAGTATTCAGTGCAGTAACATGCTGTGGAGGGTCACAGCCGAGGAGGAATAAGCTGTGCCA
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: Exon 7
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
6008
PDE
110752275 GRCh37
110858968 NCBI36
  
TTCTACAAACCCCATTAGGAAATGA T → G GTACTGGCTTTCAGTAAATAACAAT
+ 
 
n=
T/T=
T/G=
G/G=
G=
132
65
1
0
0.008
130
65
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 
6009
PDE
110752280 GRCh37
110858973 NCBI36
  
CAAACCCCATTAGGAAATGATGTAC T → G GGCTTTCAGTAAATAACAATAGAGA
+ 
 
n=
T/T=
T/G=
G/G=
G=
132
65
1
0
0.008
130
65
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 
6010
PDE
IA
110752289 GRCh37
110858982 NCBI36
  
TTAGGAAATGATGTACTGGCTTTCA G → A TAAATAACAATAGAGAAGTTGCTAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
4
18
43
0.800
130
26
32
7
0.354
136
10
34
24
0.603
130
21
33
11
0.423
PMT-272
 
6011
PDE
110752336 GRCh37
110859029 NCBI36
  
CTAATAGGCAATTAGAAACTGCCTC C → T GTGCCCCCTTGGGGAGGGTCTGCAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
65
1
0
0.008
130
65
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 
6012
PDE
110752337 GRCh37
110859030 NCBI36
  
TAATAGGCAATTAGAAACTGCCTCC G → A TGCCCCCTTGGGGAGGGTCTGCAAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
130
62
3
0
0.023
136
68
0
0
0.000
130
59
5
1
0.054
PMT-272
Exon 7: Coding
6013
PDE
110752419 GRCh37
110859112 NCBI36
15431476
TGCTGCTGAGGTCCACAGAGAACGG C → T GCCAGGATGCTGGCCAGGCGACACA
+492
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
130
65
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272
Exon 7: Coding
6014
PDE
110752455 GRCh37
110859148 NCBI36
15071440
TGGCCAGGCGACACACCATGCTGCC G → C CTTCCCACAGCCAGCGATCTGGAAA
+480
Ser → Arg
(D=110)
n=
G/G=
G/C=
C/C=
C=
132
66
0
0
0.000
130
64
1
0
0.008
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 
6015
PDE
110752546 GRCh37
110859239 NCBI36
  
AGGGATTGAGGGACCTGCTTCCTGC A → C GCTCCTTTCCCACGCTCCCCAGCAA
+ 
 
n=
A/A=
A/C=
C/C=
C=
132
51
13
2
0.129
130
65
0
0
0.000
136
68
0
0
0.000
130
64
1
0
0.008
PMT-272
 
6016
PDE
110752560 GRCh37
110859253 NCBI36
  
CTGCTTCCTGCAGCTCCTTTCCCAC G → A CTCCCCAGCAAGGATAAGGGTGGTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
64
2
0
0.015
130
65
0
0
0.000
136
67
1
0
0.007
130
58
7
0
0.054
PMT-272
 
6017
PDE
110752626 GRCh37
110859319 NCBI36
  
ACGTTTCAGTCAACCTCGGTGGCCC C → A GCGAGATTATAATAGCACATTTTTA
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
51
14
1
0.121
130
36
28
1
0.231
136
31
27
10
0.346
130
30
28
7
0.323
PMT-272
 
6018
PDE
110752627 GRCh37
110859320 NCBI36
  
CGTTTCAGTCAACCTCGGTGGCCCC G → A CGAGATTATAATAGCACATTTTTAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
64
2
0
0.015
130
65
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 
6019
PDE
110752632 GRCh37
110859325 NCBI36
  
CAGTCAACCTCGGTGGCCCCGCGAG A → G TTATAATAGCACATTTTTACTCGAC
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
57
8
1
0.076
130
54
11
0
0.085
136
63
5
0
0.037
130
58
6
1
0.062
PMT-272
 
6020
PDE
110752654 GRCh37
110859347 NCBI36
  
GAGATTATAATAGCACATTTTTACT C → T GACTTTTTCTATCTTTCAATATGTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
64
2
0
0.015
130
65
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 
6021
PDE
110752694 GRCh37
110859387 NCBI36
  
TTCAATATGTTTAGATACACAAATA T → C TTACCATTGTGTTACGACTGCCTGC
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
56
8
2
0.091
130
54
11
0
0.085
136
63
5
0
0.037
130
58
6
1
0.062
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.