UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000927
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000927 [Chr.7(-): 87133179-87342639 GRCh37]
Id:3'UTR
Position:Chr.7(+): 87132888-87133765 GRCh37
Chr.7(+): 86970824-86971701 NCBI36
Sequence:
CCTCACCCCACCTCCTAAAATCTTATATCGATCTGTGTTTTGGGTTTGAGAGCCACCTTAATGTGGAAATGCAAGAATCA
GCAGGATCAAGTCCAAGAAGAATGAAGCCAGATGGTTCTGTAAGACCCAATGTGAATAGACATATACAACAGGAATTATT
TAAACTGCTTAACCATTCCCACAAAAATGAGTAGGTATATTTAAAGAAAACTTTTTTAAAGCAGAAGTTATCTACAATAT
TCCAATTGAGAGAAGATATATTCACAGGCAGTTTGGACAAGATGACTCCAGTCACATGAAAGTTTAGTTTTATTATAGAC
ACTTTATGCAAACATTTCAATACTTTTTGCTACTT
CTATAATCTTTTAGCAAGGCAGTCAGTTACAGTCCAAATGGGAAA
ATATAAACAAAATTACACA
TTTTATCTTTTAAAATCTACTTTAATTCTGTTATAAAATTTATAATGCAGTTTAAACTATG
ATTTCTCTCCACTTGATGATGTCTCT
CACTCTGTTCCTTTAATTACGAAGTCTCTGAAGACTCTGAACTTGACTGAGGAA
ATGTTAAACAGATACCTCTTCA
TAATTCTGTAAGTGTTTGCTTTTAACTTTGAATAAATGTCATATCTAAACAAATATTA
AAAAGTATTTAACATCTCATACAGTCAGAGT
TCACTGGCGCTTTGTTCCAGCCTGGACACTGACCATTGAAAAATAGATG
CCTTTCTGTGCCAGCAGCTGCTGATGCGTGCCATGCTCCTTGACTCTGCCATTCTGAAACACCACTATTAAGTCTGCATT
CTGGATGGTGGACAGGCGGTGAGCAATCACAATGCAGGTGCGGC
CTTCTCTGGCTTTGTCCAGGGCTTCTTGGACAAC
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 29: 3UTR
5291
PDE
87133204 GRCh37
86971140 NCBI36
4691 
TCACATGAAAGTTTAGTTTTATTAT A → G GACACTTTATGCAAACATTTCAATA
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
66
0
0
0.000
126
63
0
0
0.000
134
66
1
0
0.007
128
64
0
0
0.000
PMT-272
Exon 29: 3UTR
5290
PDE
1 pubI
87133243 GRCh37
86971179 NCBI36
4652 
AACATTTCAATACTTTTTGCTACTT C → T TATAATCTTTTAGCAAGGCAGTCAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
60
6
0
0.045
126
63
0
0
0.000
134
67
0
0
0.000
128
63
1
0
0.008
PMT-272
Exon 29: 3UTR
5289
PDE
1 pubI
87133307 GRCh37
86971243 NCBI36
4588 
GGGAAAATATAAACAAAATTACACA T → G TTTATCTTTTAAAATCTACTTTAAT
+ 
 
n=
T/T=
T/G=
G/G=
G=
132
61
5
0
0.038
126
63
0
0
0.000
134
67
0
0
0.000
128
64
0
0
0.000
PMT-272
Exon 29: 3UTR
5288
PDE
7 pubsI
87133366 GRCh37
86971302 NCBI36
4529 
AAAATTTATAATGCAGTTTAAACTA T → C GATTTCTCTCCACTTGATGATGTCT
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
43
22
1
0.182
126
41
20
2
0.190
134
40
23
4
0.231
128
43
18
3
0.188
PMT-272
Exon 29: 3UTR
6142
87133394 GRCh37
86971330 NCBI36
4501 
TTTCTCTCCACTTGATGATGTCTCT C → CTGTCTCTC ACTCTGTTCCTTTAATTACGAAGTC
+ 
 
n=
C/C=
C/CTGTCTCTC=
CTGTCTCTC/CTGTCTCTC=
CTGTCTCTC=
132
59
7
0
0.053
126
63
0
0
0.000
134
67
0
0
0.000
128
62
2
0
0.016
PMT-272
Exon 29: 3UTR
5286
PDE
1 pubI
87133413 GRCh37
86971349 NCBI36
4482 
GTCTCTCACTCTGTTCCTTTAATTA C → T GAAGTCTCTGAAGACTCTGAACTTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
118
53
6
0
0.051
126
63
0
0
0.000
134
67
0
0
0.000
124
62
0
0
0.000
PMT-272
Exon 29: 3UTR
5285
PDE
1 pubI
87133470 GRCh37
86971406 NCBI36
4425 
GAAATGTTAAACAGATACCTCTTCA T → A AATTCTGTAAGTGTTTGCTTTTAAC
+ 
 
n=
T/T=
T/A=
A/A=
A=
118
42
16
1
0.153
126
55
7
1
0.071
134
67
0
0
0.000
124
55
7
0
0.056
PMT-272
Exon 29: 3UTR
5284
PDE
87133479 GRCh37
86971415 NCBI36
4416 
AACAGATACCTCTTCATAATTCTGT AAGT → - GTTTGCTTTTAACTTTGAATAA
+ 
 
n=
AAGT/AAGT=
AAGT/-=
-/-=
-=
132
59
7
0
0.053
126
63
0
0
0.000
134
67
0
0
0.000
128
64
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.