UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004790
NM_153276
NM_153277
NM_153278
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004790 [Chr.11(-): 62744069-62752495 GRCh37]
Id:3'UTR
Position:Chr.11(+): 62743882-62744334 GRCh37
Chr.11(+): 62500458-62500910 NCBI36
Sequence:
TAGAGGATGGGGGAGGGAAGAGGGAGGGATAGAAAGGGGCAAAGGCAAGAGTCTTTTCTAATTTTCTGGGATGGTTTGTA
AAGTCCCGGGGATGGAGTGGGTGGGAGGGGACTGTATGGCCTCTTGGGCTGGAAGCTGACTAAAATGGAGTGGCCATTCC
TTTTGAGACAAGAGAGACACAGAGAGATGGTGCGCAGTCAAACCTTTTAATGATGTGGTTCTGGTGGGGTTTATAAAGGG
AGGTGGACCCCTGGGAAGATGCTTTCCTGAACCACAACCCCCACACTTGGGTCACCATTTCCTCTTCCTCCTCCTTGTGT
GGGTGGCCGGAGACCTGT
AGGACCTTCCCTCCCTTTAGGGTTCTGTAAGGCCCCTTCTCAGTCCTCAGAGTCCATTCTTC
TCTTGTGCTGAGGCCTGCAGTGGGACCATATAC
TTCTGGTGCTCTTGTTGCTG
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 10: 3UTR
6236
PDE
62744220 GRCh37
62500796 NCBI36
2071 
CTTGTGTGGGTGGCCGGAGACCTGT A → G GGACCTTCCCTCCCTTTAGGGTTCT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.