UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001606
NM_212533
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001606 [Chr.9(-): 139901686-139922740 GRCh37]
Id:3'UTRa
Position:Chr.9(+): 139901500-139902102 GRCh37
Chr.9(+): 139021321-139021923 NCBI36
Sequence:
CCCTGAGGGTGGGATGAGGGGGACAGTGAACCATGGTGAACCACCCTGCCTCAGTTTCCCTCCTCCAGACCGACCCAGCC
ACCCCCTGCCAGCACCTGTGCCTGAGGGGCAGGGCCTTCTGGAGCGCTAACCCACCTGATGCGCCCATCCTCCCCACCCT
TCCCAACCCACACACGCAGACCCGCAGACATTTTGTTTATTTATTTAAAACAAACATCTGTGCGCTATGTACAGGCCCGG
CTCCCAGGGAGGTGGGCGGGCAGGGGGCCAAGCTGGGTGGGAGAGCGATGGCAGCTGGGGGTTGGGGGGGGTCTGG
CCCC
TTGCCTGGCCAGCAGGGTCAGCTTCTCCATTCCTGCCACCTGCCAGCTGGCCCAAGCTGATGGCTTCCCG
CAGGACAGCC
ACCTCCCTGCAGGAGAGCAGGGCCAGAGGAGCCTCTTCTCAAAGCAAAATAAATACGGGACTGACCCAGCTCCGCCCACA
G
CCCGCTCTCGGCATCAGCCTTCATCGTAAGAGAGAAAAGCTGGTTCCGAGGCCGGGCAGGAGAAAGGCCAGCAGTGCCT
GGTCCAGCCGGCGTCGCCTTGGGCG
GTGAGCAGTGCCAGGCAG
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTRa
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
6356
PDE
139901534 GRCh37
139021355 NCBI36
  
TGGGATGAGGGGGACAGTGAACCAT G → A GTGAACCACCCTGCCTCAGTTTCCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
136
65
3
0
0.022
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 49: 3UTR
6357
PDE
139901816 GRCh37
139021637 NCBI36
8024 
CAGCTGGGGGTTGGGGGGGGTCTGG C → T CCCTTGCCTGGCCAGCAGGGTCAGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 49: 3UTR
6358
PDE
139901890 GRCh37
139021711 NCBI36
7950 
GCTGGCCCAAGCTGATGGCTTCCCG C → A AGGACAGCCACCTCCCTGCAGGAGA
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
66
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 49: 3UTR
6359
PDE
I
139901891 GRCh37
139021712 NCBI36
7949 
CTGGCCCAAGCTGATGGCTTCCCGC A → G GGACAGCCACCTCCCTGCAGGAGAG
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
3
18
45
0.818
136
0
8
60
0.941
136
0
0
68
1.000
136
0
5
63
0.963
PMT-272
Exon 49: 3UTR
6360
PDE
I
139901981 GRCh37
139021802 NCBI36
7859 
GGGACTGACCCAGCTCCGCCCACAG C → A CCGCTCTCGGCATCAGCCTTCATCG
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
65
1
0
0.008
136
63
5
0
0.037
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 49: 3UTR
6361
PDE
139901990 GRCh37
139021811 NCBI36
7850 
CCAGCTCCGCCCACAGCCCGCTCTC G → A GCATCAGCCTTCATCGTAAGAGAGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
136
64
4
0
0.029
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.