UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001606
NM_212533
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001606 [Chr.9(-): 139901686-139922740 GRCh37]
Id:3'UTRb
Position:Chr.9(+): 139901990-139902615 GRCh37
Chr.9(+): 139021811-139022436 NCBI36
Sequence:
GGCATCAGCCTTCATCGTAAGAGAGAAAAGCTGGTTCCGAGGCCGGGCAGGAGAAAGGCCAGCAGTGCCTGGTCCAGCCG
GCGTCGCCTTGGGCGGT
GAGCAGTGCCAGGCAGGGGCGAGGGGCCGGGCAGACCCCGAGGCTTTAAGGCAAAGCAGGGCA
AGGGTGTACGCAGCCC
GGGCCGGGTCAGCCTTTGGCACAATTAGGGGCGGCAACCGCAGTGACCACAGGGCATGGCCGAG
TACAGGGGCTGGAGGAC
CAGAAGCCCCTTGGTCCTGAACCTCCACTCCAGGCCCTGGCAGGCACTGGGGGACTTCTGTCC
CCATTGTTGAGTCCCTGGCCCAGCTCTGGGTGGTCAGTGGAGCGTGTCCTCCCTGGCCCAGCTCTGGGTGG
TCAGCAGAG
CGTGTCCGTGTTGAAGGACAGCTGGGCCTGTGCACAGGGGAGGTCAGGCTTATGGGGCATCCTGTGCCACCCCCTGCTGG
GGCTGAGGACACTTGTGCTGGCCCGCCCCGGCCCTCCTGCAGGCTGGGCCTGGACGCAGGGTCTCCCCACGAGCTCCCTC
TGTGTCTGGGCTCTCCCGGGCCTCCGTCTGCCGAGTCTGGGGGCCACTGAGTCTACATCGGTCCCC
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTRb
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 49: 3UTR
6384
PDE
139902087 GRCh37
139021908 NCBI36
7753 
TCCAGCCGGCGTCGCCTTGGGCGGT G → A AGCAGTGCCAGGCAGGGGCGAGGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
134
67
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 49: 3UTR
6385
PDE
139902166 GRCh37
139021987 NCBI36
7674 
AGCAGGGCAAGGGTGTACGCAGCCC G → A GGCCGGGTCAGCCTTTGGCACAATT
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
35
24
6
0.277
134
44
20
3
0.194
136
46
19
3
0.184
134
19
39
9
0.425
PMT-272
Exon 49: 3UTR
6386
PDE
139902214 GRCh37
139022035 NCBI36
7626 
ATTAGGGGCGGCAACCGCAGTGACC A → G CAGGGCATGGCCGAGTACAGGGGCT
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
3
18
44
0.815
134
0
8
59
0.940
136
0
0
68
1.000
134
0
5
62
0.963
PMT-272
Exon 49: 3UTR
6387
PDE
139902247 GRCh37
139022068 NCBI36
7593 
TGGCCGAGTACAGGGGCTGGAGGAC C → T AGAAGCCCCTTGGTCCTGAACCTCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 49: Coding
6388
PDE
139902389 GRCh37
139022210 NCBI36
74517303
GGCCCAGCTCTGGGTGGTCAGCAGA G → A CGTGTCCGTGTTGAAGGACAGCTGG
+2435
Leu → Phe
(D=22)
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
 
6389
PDE
139902445 GRCh37
139022266 NCBI36
  
TGCACAGGGGAGGTCAGGCTTATGG G → C GCATCCTGTGCCACCCCCTGCTGGG
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.