UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004915
NM_016818
NM_207174
NM_207627
NM_207628
NM_207629
XM_005261209
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004915 [Chr.21(+): 43639267-43717354 GRCh37]
Id:3'UTRa
Position:Chr.21(+): 43716154-43716844 GRCh37
Chr.21(+): 42589223-42589913 NCBI36
Sequence:
CTTTGGGAAGGGAGGATAGCCAAGCTGGGAATCGCAGGGAGGGTGAACGACATTGACCTTCAGCCAACGGCGTGGCTGGC
TGGGAGAACGTCCTCCCTCATGCCTGGCCTTTCCTCCTAGGTATGGGTTCGAAGGGGTCATCCTCTCCATCTATGGCTTA
GACCGGGAAGATCTGCACTGTGACATCGACGAGAC
GTGCCACTTCCAGAAGTCGGAGGCCATCCTGCGGGAGCTGGACGT
GGAAAATGCCAAGCTGTACCTGGACTTCATCGTACTCGGGATTTTCTTCATCTCCCTCCGCCTCATTGCCTATTTTGTCC
TCAGGTACAAAATCCGGGCAGAGAGGTAA
AACACCTGAATGCCAGGAAACAGGAAGATTAGACACTGTGGCCGAGGGCAC
GTCTAGAATCGAGGAGGCAAGCCTGTGCCCGACCGACGACACAGAGACTCTTCTGATCCAACCCCTAGAACCGCGTTGGG
TTTGTGGGTGTCTC
GTGCTCAGCCACTCTGCCCAGCTGGGTTGGATCTTCTCTCCATTCCCCTTTCTAGCTTTAACTAGG
AAGATGTAGGCAGATTGGTGGTTTTTTTTTTTTTAACATACAGAATTTTAAATACCACAACTGGGGCAGAATTTAAAGCT
GCAACACAGCTGGTGATGAGAGGCTTCCTCA
GTCCAGTCGCTCCTTAGCAC
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTRa
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
6505
PDE
I
43716241 GRCh37
42589310 NCBI36
  
GCCAACGGCGTGGCTGGCTGGGAGA A → G CGTCCTCCCTCATGCCTGGCCTTTC
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
29
27
12
0.375
136
68
0
0
0.000
134
67
0
0
0.000
132
63
3
0
0.023
PMT-272
 
6506
PDE
43716242 GRCh37
42589311 NCBI36
  
CCAACGGCGTGGCTGGCTGGGAGAA C → T GTCCTCCCTCATGCCTGGCCTTTCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 15: Coding
6507
PDE
43716349 GRCh37
42589418 NCBI36
19901884
ATCTGCACTGTGACATCGACGAGAC G → A TGCCACTTCCAGAAGTCGGAGGCCA
+628
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 15: 3UTR
6508
PDE
43716548 GRCh37
42589617 NCBI36
2189 
CAGGAAGATTAGACACTGTGGCCGA G → C GGCACGTCTAGAATCGAGGAGGCAA
+ 
 
n=
G/G=
G/C=
C/C=
C=
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 15: 3UTR
6509
PDE
43716554 GRCh37
42589623 NCBI36
2195 
GATTAGACACTGTGGCCGAGGGCAC G → A TCTAGAATCGAGGAGGCAAGCCTGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
66
2
0
0.015
136
66
2
0
0.015
134
67
0
0
0.000
132
48
17
1
0.144
PMT-272
Exon 15: 3UTR
6510
PDE
43716558 GRCh37
42589627 NCBI36
2199 
AGACACTGTGGCCGAGGGCACGTCT A → G GAATCGAGGAGGCAAGCCTGTGCCC
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
67
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 15: 3UTR
6511
PDE
43716583 GRCh37
42589652 NCBI36
2224 
AGAATCGAGGAGGCAAGCCTGTGCC C → T GACCGACGACACAGAGACTCTTCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
66
2
0
0.015
134
67
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 15: 3UTR
6512
PDE
43716588 GRCh37
42589657 NCBI36
2229 
CGAGGAGGCAAGCCTGTGCCCGACC G → A ACGACACAGAGACTCTTCTGATCCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
65
3
0
0.022
136
68
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 15: 3UTR
6513
PDE
43716648 GRCh37
42589717 NCBI36
2289 
ACCGCGTTGGGTTTGTGGGTGTCTC G → A TGCTCAGCCACTCTGCCCAGCTGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
134
65
2
0
0.015
132
66
0
0
0.000
PMT-272
Exon 15: 3UTR
6514
PDE
43716653 GRCh37
42589722 NCBI36
2294 
GTTGGGTTTGTGGGTGTCTCGTGCT C → A AGCCACTCTGCCCAGCTGGGTTGGA
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.