UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004915
NM_016818
NM_207174
NM_207627
NM_207628
NM_207629
XM_005261209
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_004915 [Chr.21(+): 43639267-43717354 GRCh37]
Id:3'UTRb
Position:Chr.21(+): 43716666-43717486 GRCh37
Chr.21(+): 42589735-42590555 NCBI36
Sequence:
CAGCTGGGTTGGATCTTCTCTCCATTCCCCTTTCTAGCTTTAACTAGGAAGATGTAGGCAGATTGGTGGTTTTTTTTTTT
TTAACATACAGAATTTTAAATACCACAACTGGGGCAGAATTTAAAGCTGCAACACAGCTGGTGATGAGAGGCTTCCTCAG
TCCAGTCGCTCCTTAGCACCAGGCACCGTGGGTCCTGGATGGGGAACTGCAAGCAGCCTCTCAGCTGATGGCTGC
ACAGT
CAGATGTCTGGTGGCAGAGAGTCCGAGCATGGAGCGATTCCATTTTATGACTGTTGTTTTTCACATTTTCATCTTTCTAA
GGTGTGTCTCTTTTCCAATGAGAAGTCATTTTTGCAAGCCAAAAGTCGATCAATCGCATTCATTTTAAGAAATTATACCT
TTTTAGTACTTGCTGAAGAATGATTCAGGGTAAATCACATACTTTGTTTAGAGAGGCGAGGGGTTTAACCGAGTCACCCA
GCTGGTCTCATACATAGACAGCACTTGTGAAG
GATTGAATGCAGGTTCCAGGTGGAGGGAAGACGTGGACACCATCTCCA
CTGAGCCATGCAGACATTTTTAAAAGCTATACAAAAAATTGTGAGAAGACATTGGCCAACTCTTTCAAAGTCTTTCTTTT
TCCACGTGCTTCTTATTTTAAGCGAAATATATTGTTTGTTTCTTCCTAA
CTTTCTGACTACCTTTAATTTTGCCTAGGTT
GATTTAAACAAACAAACAAACAGCTTCCCTTTCCTCCTGTATCACCTCAGCTGCCTCCACTGAACCTGGAAGAATGGGGC
TTAGGGAAATTCAGGCACGAC
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTRb
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 15: 3UTR
6523
PDE
3 pubsI
43716901 GRCh37
42589970 NCBI36
2542 
AAGCAGCCTCTCAGCTGATGGCTGC A → G CAGTCAGATGTCTGGTGGCAGAGAG
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
13
31
24
0.581
134
12
32
23
0.582
130
17
28
20
0.523
132
18
30
18
0.500
PMT-272
Exon 15: 3UTR
6524
PDE
43717178 GRCh37
42590247 NCBI36
2819 
TCATACATAGACAGCACTTGTGAAG G → A ATTGAATGCAGGTTCCAGGTGGAGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
134
67
0
0
0.000
130
64
1
0
0.008
132
66
0
0
0.000
PMT-272
 
6525
PDE
43717409 GRCh37
42590478 NCBI36
  
TTGATTTAAACAAACAAACAAACAG C → T TTCCCTTTCCTCCTGTATCACCTCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
44
20
4
0.206
134
62
5
0
0.037
130
65
0
0
0.000
132
61
5
0
0.038
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.