UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_020372
NM_016609
XM_005267748
XM_005267747
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_020372 [Chr.14(-): 23815527-23821479 GRCh37]
Id:3'UTRa
Position:Chr.14(+): 23815441-23815860 GRCh37
Chr.14(+): 22885281-22885700 NCBI36
Sequence:
TGTTATCGGTGTGCATTCCACTGAGAAAAACCTTCCCCCAAGAGATAGAAGGACAAACAGAAGGGAGGGAAGTCCAGGCT
ATGATATGCTCGTTTATTCCAAATGTCTTTATTGAAACAGAATGATAGAGCAAGAAATAATGAGGTCTGGGTGGATGTCT
TTGGGCGCAGGATGGAGCCCAGACCCAGTGGTTACAGTGTGGAGCTCTCTCCCTGTCCCCTGACTCTGGCCAAGGAAGTG
AATGCAAAGCAGCAGGGAGGAGGCAGGGTGGGGACGGCCCTCTGAGCTCTCCGCGATGGCTGGCGTGAGGTGCCTCTGAG
ACTTCTGGGCAGCCCTGCCTTCCCTACTCAGTCTTCCCGATCTTCTTGCCACCTTTCTGTGTGGGCCAGCCTCC
CGCCAG
GGTACTCAGAGGCCGCTCAG
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTRa
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 9: 3UTR
6556
PDE
23815835 GRCh37
22885675 NCBI36
1695 
CACCTTTCTGTGTGGGCCAGCCTCC C → T GCCAGGGTACTCAGAGGCCGCTCAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
0
0
67
1.000
136
0
0
68
1.000
134
0
1
66
0.993
130
0
0
65
1.000
PMT-272
Exon 9: 3UTR
6557
PDE
23815836 GRCh37
22885676 NCBI36
1694 
ACCTTTCTGTGTGGGCCAGCCTCCC G → A CCAGGGTACTCAGAGGCCGCTCAGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
64
3
0
0.022
136
68
0
0
0.000
134
67
0
0
0.000
130
65
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.