UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_004915
NM_016818
NM_207174
NM_207627
NM_207628
NM_207629
XM_005261209
Transcript:NM_004915 [Chr.21(+): 43639267-43717354 GRCh37]
Id:5'UTR
Position:Chr.21(+): 43619611-43620092 GRCh37
Chr.21(+): 42492680-42493161 NCBI36
Sequence:
ACTTGGGTCCTTCTGTGGACAGGTACTAGGTGCTGCTTTACGCCCAGTGACTTGTGAGGGAACAGAACTGCCCTTTAGTA
ACCCTGCTCACTTCCTGTTTTCTGCAGTAACAATTACATTAGGCAATATTATTACACATGGAATTGCATCATGCTGATTT
TAAAACAATCCTCCCTGTAGCATTACACAGACACTGAATCATCATTTGTAGTTTGGGGGGCTTTACATGCCTGCAGTGGT
GAAAACTGAAATTTTGTCCCACTTAAGGGAGTTTCTTCTTCCCTTTATTAATTGCAAAATAAATATATGTCACTTCAGAG
GGCAGCAGCTGGACTACCTATGTTTGTGGGTAAGTCACTGACAAAATGCTTTCTAGTAAGAAAATATCTTTAAATATAAA
TGTATGGAATAAGTGTAATTAACTAGATGTAGATTAAGAAAAATGTAAGCCACATCTCCTAGTTCAGGCAGCAATCATTT
GT
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 5'UTR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
6567
PDE
3 pubsI
43619665 GRCh37
42492734 NCBI36
-19602-19708
GTGCTGCTTTACGCCCAGTGACTTG T → G GAGGGAACAGAACTGCCCTTTAGTA
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
11
28
29
0.632
136
37
30
1
0.235
136
24
33
11
0.404
136
30
27
11
0.360
PMT-272
 
6568
PDE
43619695 GRCh37
42492764 NCBI36
-19572-19678
GAACAGAACTGCCCTTTAGTAACCC T → C GCTCACTTCCTGTTTTCTGCAGTAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
67
1
0
0.007
136
56
11
1
0.096
136
68
0
0
0.000
136
63
5
0
0.037
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.