UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_020372
NM_016609
XM_005267748
XM_005267747
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_020372 [Chr.14(-): 23815527-23821479 GRCh37]
Id:3'UTRb
Position:Chr.14(+): 23815749-23816344 GRCh37
Chr.14(+): 22885589-22886184 NCBI36
Sequence:
GGTGCCTCTGAGACTTCTGGGCAGCCCTGCCTTCCCTACTCAGTCTTCCCGATCTTCTTGCCACCTTTCTGTGTGGGCCA
GCCTCC
CGCCAGGGTACTCAGAGGCCGCTCAGAGGGCAGGGTTGGGGGTGGCAAGCAGCGGGACGTGGTCACAGCGGGTA
GGGGGTGGCTGCCGCAGCAGGGAAGGCCGGCGACACAGCTCCCCGTCCCGGAGCACCTCGGGCAGGAGCTTGCGCTTGGT
CTCCGGCAGCAGCATAATGCTGAGAATGCAGAGGAGGGCGCAGGC
CGCCAGCACCACGTGCTGCAGGAAGGCTCCATGGC
CCATGTGGAGGCGCTGGGCCGGGCCGCTCAGTCCTCCAAGCGCCCCTAGAGCCATGATCAGGCCCAGGCCACGGCCC
CTG
GGGGGAGACAGAGGAGGAGCTCAGCCCACAGCTGTAGCCTTGCTGGGCCCTTCTCCCGCAGCCCCCCTCCTCCAGCCCGC
AGGCCCTGTCCTCAGGGGTGGGGTGGGGGAGCGGGAGGCGAGGGGGCCCGGCTCTGCCCCTGGGGGCACCCCTGCTCTCA
CCGGACAGTGGTGGGGATGACCTCAGCAGCAAGGAG
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTRb
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 9: 3UTR
6556
PDE
23815835 GRCh37
22885675 NCBI36
1695 
CACCTTTCTGTGTGGGCCAGCCTCC C → T GCCAGGGTACTCAGAGGCCGCTCAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 9: 3UTR
6557
PDE
23815836 GRCh37
22885676 NCBI36
1694 
ACCTTTCTGTGTGGGCCAGCCTCCC G → A CCAGGGTACTCAGAGGCCGCTCAGA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
64
4
0
0.029
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 9: Coding
6569
PDE
23815909 GRCh37
22885749 NCBI36
16211565
CAGCGGGACGTGGTCACAGCGGGTA G → A GGGGTGGCTGCCGCAGCAGGGAAGG
+522
Pro → Leu
(D=98)
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 9: Coding
6570
PDE
23815981 GRCh37
22885821 NCBI36
15491493
CCGGAGCACCTCGGGCAGGAGCTTG C → T GCTTGGTCTCCGGCAGCAGCATAAT
+498
Arg → His
(D=29)
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 9: Coding
6571
PDE
23816034 GRCh37
22885874 NCBI36
14961440
TGAGAATGCAGAGGAGGGCGCAGGC C → T GCCAGCACCACGTGCTGCAGGAAGG
+480
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 9: Coding
6572
PDE
23816039 GRCh37
22885879 NCBI36
14911435
ATGCAGAGGAGGGCGCAGGCCGCCA G → T CACCACGTGCTGCAGGAAGGCTCCA
+479
Leu → Met
(D=15)
n=
G/G=
G/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 9: Coding
6573
PDE
23816040 GRCh37
22885880 NCBI36
14901434
TGCAGAGGAGGGCGCAGGCCGCCAG C → T ACCACGTGCTGCAGGAAGGCTCCAT
+478
Val = Val
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 
6574
PDE
23816261 GRCh37
22886101 NCBI36
  
GTCCTCAGGGGTGGGGTGGGGGAGC G → A GGAGGCGAGGGGGCCCGGCTCTGCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
 
6575
PDE
23816277 GRCh37
22886117 NCBI36
  
TGGGGGAGCGGGAGGCGAGGGGGCC C → T GGCTCTGCCCCTGGGGGCACCCCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.