UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000492
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000492 [Chr.7(+): 117120017-117308719 GRCh37]
Id:3'UTRa
Position:Chr.7(+): 117306783-117307483 GRCh37
Chr.7(+): 117094019-117094719 NCBI36
Sequence:
ACCTCCTTAGAGCAAAAGGACACAGCAGTTAAATGTGACATACCTGATTGTTCAAAATGCAAGGCTCTGGACATTGCATT
CTTTGACTTTTATTTTCCTTTGAGCCTGTGCCAGTTTCTGTCCCTGCTCTGGTCTGACCTGCCTTCTGTCCCAGATCTCA
CTAACAGCCATTTCCCTAGGTCATAGAAGAGAACAAAGTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGGA
GCCTCTTCCGGCAAGCCATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAAGTGCAAGTCTAAG
CCCCA
GATTGCTGCTCTGAAAGAGGAGACAGAAGAAGAGGTGCAAGATACAAGGCTTTAGAGAGCAGCATAAATGTTGAC
ATGGGACATTTGCTCATGGAATTGGAGCTCGTGGGACAGTCACCTCATGGAATTGGAGCT
CGTGGAACAGTTACCTCTGC
CTCAGAAAACAAGGATGAATTAA
GTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAATTGAGGACACTGATATGGGTC
TTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGC
AAGCCAGATTTTCCTGAAAACCCTTGCCATGTGCTAGTAA
TTGGAAAGGCAGCTCTAAATG
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTRa
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
6606
PDE
1 pub
117306957 GRCh37
117094193 NCBI36
  
CCCAGATCTCACTAACAGCCATTTC C → T CTAGGTCATAGAAGAGAACAAAGTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: Coding
6607
PDE
117306991 GRCh37
117094227 NCBI36
44044272
TAGAAGAGAACAAAGTGCGGCAGTA C → T GATTCCATCCAGAAACTGCTGAACG
+1424
Tyr = Tyr
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 27: Coding
6608
PDE
4 pubsI
117307108 GRCh37
117094344 NCBI36
45214389
CAAGCAAGTGCAAGTCTAAGCCCCA G → A ATTGCTGCTCTGAAAGAGGAGACAG
+1463
Gln = Gln
n=
G/G=
G/A=
A/A=
A=
132
40
23
3
0.220
136
43
22
3
0.206
136
66
2
0
0.015
136
55
12
1
0.103
PMT-272
Exon 27: 3UTR
6609
PDE
117307243 GRCh37
117094479 NCBI36
4656 
ACAGTCACCTCATGGAATTGGAGCT C → T GTGGAACAGTTACCTCTGCCTCAGA
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: 3UTR
6610
PDE
117307286 GRCh37
117094522 NCBI36
4699 
GCCTCAGAAAACAAGGATGAATTAA G → GC TTTTTTTTTAAAAAAGAAACATTTG
+ 
 
n=
G/G=
G/GC=
GC/GC=
GC=
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: 3UTR
6611
117307295 GRCh37
117094531 NCBI36
4708 
AACAAGGATGAATTAAGTTTTTTTT T → - AAAAAAGAAACATTTGGTAAGGGGA
+ 
 
n=
T/T=
T/-=
-/-=
-=
136
3
21
44
0.801
136
34
31
3
0.272
136
33
26
9
0.324
136
28
30
10
0.368
PMT-272
Exon 27: 3UTR
6612
PDE
117307306 GRCh37
117094542 NCBI36
4719 
ATTAAGTTTTTTTTTAAAAAAGAAA C → T ATTTGGTAAGGGGAATTGAGGACAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.