UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000492
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000492 [Chr.7(+): 117120017-117308719 GRCh37]
Id:3'UTRb
Position:Chr.7(+): 117307352-117308058 GRCh37
Chr.7(+): 117094588-117095294 NCBI36
Sequence:
GGCTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAGAT
TTTCCTGAAAACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCAGCCTAGTTGATCAGCTTATTG
TCTAGTGAAACTCGTTAATTTGTAGTGTTGGAGAAGAACTGAAATCATACTTCTTAGGGTTATGATTAAGTAATGATAAC
TGGAAACTTCAGCGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTG
TTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCACATCAAAATAT
GCCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAGTATTGTCCAGGTCTA
CCAAAAATCTCAATATTTCAGATAATCACAATACATCCCTTACCTGGGAAAGGGCTGTTATAATCTTTCACAGGGGACAG
GATGGTTCCCTTGATGAAGAAGTTGATATGCCTTTTCCCAACTCCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAG
TTTAGCTGGAAAAGTATGTTAGTGCAAATTGTCACAGGACAGCCCTTCTTTCCACAGAAGCTCCAGG
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTRb
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 27: 3UTR
6603
PDE
117307460 GRCh37
117094696 NCBI36
4873 
CCTGAAAACCCTTGCCATGTGCTAG T → A AATTGGAAAGGCAGCTCTAAATGTC
+ 
 
n=
T/T=
T/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272
Exon 27: 3UTR
6604
PDE
I
117307487 GRCh37
117094723 NCBI36
4900 
ATTGGAAAGGCAGCTCTAAATGTCA A → G TCAGCCTAGTTGATCAGCTTATTGT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
53
15
0
0.110
136
68
0
0
0.000
136
67
1
0
0.007
136
67
1
0
0.007
PMT-272
Exon 27: 3UTR
6605
PDE
117307846 GRCh37
117095082 NCBI36
5259 
GTCCAGGTCTACCAAAAATCTCAAT A → G TTTCAGATAATCACAATACATCCCT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.