UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_032583
NM_033151
NM_145186
XM_005256209
XM_005256210
XM_005256208
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_032583 [Chr.16(-): 48200822-48269088 GRCh37]
Id:3'UTR
Position:Chr.16(+): 48200637-48201339 GRCh37
Chr.16(+): 46758138-46758840 NCBI36
Sequence:
ATGGTGGCACATGCTTGTAATCCTAGCTATTCAGGAGGCTGAGGCAGGAGAATTGCTTGAACCTGGGAGGCAGAGGCTAC
AGTGAGCTGAGATTGCGCCACTGCGCTCCAGCCTGGGCAACAGAGCAAGACCCTGTCTAAAAAAACAAAAAGAAAAGAAA
CGAAAGGAAGCAGAACAAAGAAAGTGAGTTTTCCTTAGTTTTATATTTTACAAAGTCAGTACAGCATTTGCAACACTTCT
AACACAGATCAGAAAACTATAAGCTTTTACCTTATTATAAAATTATTCAGCATGTAAGTTAAAAGGA
GAACCACATGATC
ACTGAATCCCATGTCTTAGATGGTTCTGGGGTTCTAAGGT
CTTGAGAGCCATCAAGTAGCCTATTCCAGGGTTTCCATCC
AGCAATCCCCACCCCCCCTACATTTACCCCTGCTTCCAGGAGAAGTTCTCATCTCCAAACAAGAAGGTCGCAGACTGTGG
GCCTCGAAGCTGCACCTGTGTGAACCTCTGAGCTCAGCTGCCAGCCTCCATGAAGTCTCCACATCTCC
TTATCTCAGTGA
AGAAGTGGCTGTGGCCATGAGGGCTGCGAACAATGACCCAGGCTTCTTCCGCAGTACCTCCGGCCGATCAAATTCTACCA
C
CTGGAGGGTAGAGAAAGGCGAGGGGAGGATCAGGGCACAGCTGAGCTTGTGTCCTTGGAGGA
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTR
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
6635
PDE
48200732 GRCh37
46758233 NCBI36
  
CAGAGGCTACAGTGAGCTGAGATTG C → A GCCACTGCGCTCCAGCCTGGGCAAC
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
58
9
1
0.081
134
58
8
1
0.075
136
62
6
0
0.044
136
63
4
1
0.044
PMT-272
 
6636
PDE
48200807 GRCh37
46758308 NCBI36
  
CAAAAAGAAAAGAAACGAAAGGAAG C → T AGAACAAAGAAAGTGAGTTTTCCTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 30: 3UTR
6637
PDE
48200841 GRCh37
46758342 NCBI36
4557 
GAAAGTGAGTTTTCCTTAGTTTTAT A → G TTTTACAAAGTCAGTACAGCATTTG
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
66
2
0
0.015
134
54
13
0
0.097
136
68
0
0
0.000
136
58
10
0
0.074
PMT-272
Exon 30: 3UTR
6638
PDE
48200944 GRCh37
46758445 NCBI36
4454 
TTATTCAGCATGTAAGTTAAAAGGA G → A AACCACATGATCACTGAATCCCATG
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
134
67
0
0
0.000
136
65
3
0
0.022
136
68
0
0
0.000
PMT-272
Exon 30: 3UTR
6639
PDE
48200997 GRCh37
46758498 NCBI36
4401 
TTAGATGGTTCTGGGGTTCTAAGGT C → T TTGAGAGCCATCAAGTAGCCTATTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
63
5
0
0.037
134
67
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.