UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_000492
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_000492 [Chr.7(+): 117120017-117308719 GRCh37]
Id:3'UTRc
Position:Chr.7(+): 117307938-117308809 GRCh37
Chr.7(+): 117095174-117096045 NCBI36
Sequence:
TATGCCTTTTCCCAACTCCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAGTTTAGCTGGAAAAGTATGTTAGTGCA
AATTGTCACAGGACAGCCCTTCTTTCCACAGAAGCTCCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTGGG
TAGACACACATGAAGTCCAAGCATTTAGATGTATAGGTTGATGGTGGTATGTTTTCAGGCTAGATGTATGTACTTCATGC
TGTCTACACTAAGAGA
GAATGAGAGACACACTGAAGAAGCACCAATCATGAATTAGTTTTATATGCTTCTGTTTTATAAT
TTTGTGAAGCAAAATTTTTTCTCTAGGAAATATTTATTTTAATAATGTTTCAAACATATATAACAATGCTGTATTTTAAA
AGAATGATTATGAATTACATTTGTATAAAATAATTTTTATATTTGAAATATTGACTTTTTATGGCACTAGTAT
TTCTATG
AAATATTATGTTAAAACTGGGACAGGGGAGAACCTAGG
GTGATATTAACCAGGGGCCATGAATCACCTTTTGGTCTGGAG
GGAAGCCTTGGGGCTGATGCAGTTGTTGCCCACAGCTGTATGATTCCCAGCCAGCA
CAGCCTCTTAGATGCAGTTCTGAA
GAAGATGGTACCACCAGTCTGACTGTTTCCATCAAGGGTACACTGCCTTCTCAACTCCAAACTGACTCTTAAGAAGACTG
CATTATATTTATTACTGTAAGAAAATATCACTTGTCAATAAAATCCATACATTTGTGTGAAA
CTTTGTTGTTTTCAGATG
CGTTCACTTGTCATGTTTCATCAGTCTCTCACTCCAATTTCTAAGCTTCATGGAACATGAAACACGAATCTG
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: 3'UTRc
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 27: 3UTR
6648
PDE
117308194 GRCh37
117095430 NCBI36
5607 
ACTTCATGCTGTCTACACTAAGAGA GA → - ATGAGAGACACACTGAAGAAGCAC
+ 
 
n=
GA/GA=
GA/-=
-/-=
-=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: 3UTR
6649
PDE
1 pubA
117308205 GRCh37
117095441 NCBI36
5618 
TCTACACTAAGAGAGAATGAGAGAC A → C CACTGAAGAAGCACCAATCATGAAT
+ 
 
n=
A/A=
A/C=
C/C=
C=
134
64
3
0
0.022
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: 3UTR
6650
PDE
117308411 GRCh37
117095647 NCBI36
5824 
TATTGACTTTTTATGGCACTAGTAT T → C TCTATGAAATATTATGTTAAAACTG
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 27: 3UTR
6651
PDE
I
117308413 GRCh37
117095649 NCBI36
5826 
TTGACTTTTTATGGCACTAGTATTT C → T TATGAAATATTATGTTAAAACTGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
40
24
3
0.224
136
43
22
3
0.206
136
66
2
0
0.015
136
55
12
1
0.103
PMT-272
Exon 27: 3UTR
6652
PDE
117308456 GRCh37
117095692 NCBI36
5869 
AAACTGGGACAGGGGAGAACCTAGG G → A TGATATTAACCAGGGGCCATGAATC
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
66
2
0
0.015
PMT-272
Exon 27: 3UTR
6653
PDE
117308554 GRCh37
117095790 NCBI36
5967 
ACAGCTGTATGATTCCCAGCCAGCA C → G AGCCTCTTAGATGCAGTTCTGAAGA
+ 
 
n=
C/C=
C/G=
G/G=
G=
134
66
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.