UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001043
NM_001172501
NM_001172504
NM_001172502
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001043 [Chr.16(+): 55690352-55737700 GRCh37]
Id:SLC6A2-P SEQ
Position:Chr.16(+): 55689343-55690191 GRCh37
Chr.16(+): 54246844-54247692 NCBI36
Sequence:
ACCTGCTACCCTGCCCATAAATAACAGAGATGCAGGAGTAAGTGCTGGGCTGTGACCTGTCAACATGCTAAGCCGCTCAA
ACAAAACTGCCCAACAGCCCGCTGGCCGCCTATTTGCAGCACTGGGCCCTGAGCCGCACATTCCCATTTCGTTGATAAAG
AAACTGACCAGATAGTTTAAGTGGCCTGCTGCGGAAGACAGAGCTGGTGCTGCACCGGTCGCTGCTTCCCCAGTCCTTTT
TTGGCCTCCTTTCTGACGCGACGCAGACCCCAGTTCTGGAGAGTCTGTCACTCGCTCCCCGTGGTGGGAGATCAGAGGCC
TGGTGTCCTTGGGAGCGGCGAGCGGTGCTCGGCGCAGGATAGAAAGGGAGTGCGCGCCCGAGTCCCCCAGATCCCTGGGA
ACCCGCGCCACCCTCCCGCCCCTGCCCATCCCCGGCCGCGCTGTCAGTCTCCATTAGCGCTAACAGGCTCCAGACGGAGC
GGGCCGGGCGCTGGGTTAATGCAATCGGCGCGTTACCTGGGGCGCAGGCTACATTACCAGCCCGGCCCCCGCCAGGCACG
GCCAGAACCAGTCAGCCCGCGCCCTGCCGGCCGCCCCGCGCCTCCAGCTCTTCCCCGGCCCCGCCCGAACGCCACACGGC
GGAGCCCAGCCCCAGCCCGCGCCCTAGAGCCTGCCAAGGCGCCGCCGGTCGGGGGCCGGCAGGGCGCAAGGCACCAGGGA
TCCCCTCGCCGCCGGACACGTGAGTGCGCCCTGAGCGCGGGACAGGGCTAGGTCTGCCTGGGAGGCCCGGGCCGAGACGC
GCCAGCAGAGGGCTAGCGAGTTTGTAGTGCAGTGACGTTAAGTGTCCGA
Color Legend: SNP  UTR  CODING
Sample Sets: PMT-272
Assays: SLC6A2-P
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
3004
PDE
55689822 GRCh37
54247323 NCBI36
-530-785
TAGCGCTAACAGGCTCCAGACGGAG C → T GGGCCGGGCGCTGGGTTAATGCAAT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
128
63
1
0
0.008
PMT-272
 
3005
PDE
55689934 GRCh37
54247435 NCBI36
-418-673
ACCAGTCAGCCCGCGCCCTGCCGGC C → A GCCCCGCGCCTCCAGCTCTTCCCCG
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
128
63
1
0
0.008
PMT-272
 
3006
PDE
55690054 GRCh37
54247555 NCBI36
-298-553
GGTCGGGGGCCGGCAGGGCGCAAGG C → T ACCAGGGATCCCCTCGCCGCCGGAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
61
5
0
0.038
132
66
0
0
0.000
132
66
0
0
0.000
128
64
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.