UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001650
NM_004028
XM_005258257
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001650 [Chr.18(-): 24432007-24445716 GRCh37]
Id:Exon_1
Position:Chr.18(-): 24445484-24446010 GRCh37
Chr.18(-): 22699482-22700008 NCBI36
Sequence:
AATTGCCCAATTTCAACTACAACATATAACCAAACAAGACAAATTCTGAACAATTCTTCATGGTAGAAAGAATTCAAATA
AAGATTTAAGGAAATCCTCATTTTCAAAAATTACTGTCTCAAAAAAAAAAAAATTAAGTAAATGTTTTTGCATTCCTGAA
ATGCCCTGTGTCTACAGTGATCAGGTACAGAAAAGCTACTTCAAGTTCAAATATAACTTAGCGATTGCCACATGGTGCAG
AATCTTTCCACCCCTAACACTCCAAAAACCCAATCAGACAAGTGGCCGTAATCTGACTCCCAGCACACAGGGAGCTGCGG
GGCAGGCAATGAGAGCTGCACTCTGGCTGGGGAAGGC
ATGAGTGACAGACCCACAGCAAGGCGGTGGGGGTAAGTCCTTC
TTTGCCTTAAGGGAACAACGCTTAGGGCCAAAAGATGAAACTGTCTCTTTTATTATAGATGTTTGTGCCTTCTTAGGCAG
AATCTGGAAGGCAGCTATAGGGCAGGTGGGTGGTTCTTTTAGATCTG
Color Legend: SNP  UTR  CODING
Sample Sets: D76SampleSet
Assays: AQP4-1
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Promoter
3129
PDE
A
24445847 GRCh37
22699845 NCBI36
-131-194
TAAATGTTTTTGCATTCCTGAAATG C → T CCTGTGTCTACAGTGATCAGGTACA
- 
 
n=
C/C=
C/T=
T/T=
T=
94
41
5
1
0.074
82
26
15
0
0.183
94
22
15
10
0.372
94
32
14
1
0.170
D76SampleSet
Exon 1: 5UTR
Promoter
3130
PDE
24445695 GRCh37
22699693 NCBI36
22-42
ATCTGACTCCCAGCACACAGGGAGC T → C GCGGGGCAGGCAATGAGAGCTGCAC
- 
 
n=
T/T=
T/C=
C/C=
C=
94
45
2
0
0.021
82
41
0
0
0.000
94
47
0
0
0.000
94
47
0
0
0.000
D76SampleSet
Exon 1: 5UTR
Promoter
3131
PDE
24445692 GRCh37
22699690 NCBI36
25-39
TGACTCCCAGCACACAGGGAGCTGC G → A GGGCAGGCAATGAGAGCTGCACTCT
- 
 
n=
G/G=
G/A=
A/A=
A=
94
41
5
1
0.074
82
26
15
0
0.183
94
22
15
10
0.372
94
33
13
1
0.160
D76SampleSet

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.