UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001650
NM_004028
XM_005258257
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001650 [Chr.18(-): 24432007-24445716 GRCh37]
Id:Exon_3
Position:Chr.18(-): 24440875-24441496 GRCh37
Chr.18(-): 22694873-22695494 NCBI36
Sequence:
CAAACTCCTGTTTGGTCGTTGTAAGAGTAATCACAGTCATCTGTGATGACCCAAAATGAATATAAATTTATTCCTTCTTT
TTGGGGGGTGAGAGAAGGAAATTCTCAGTTGAAGGTGGGGTAGAAGACTTACCTTTACTTTTTACACAGATAAAATGTGC
CTTTCACAATGATATTAATACATTGTCATCGAAAATACTCTTGCTTCAATTCTGATGGAATATTTTTCTTTCTCTAGGTT
CATGGAAATCTTACCGCTGGTCATGGTCTCCTGGTTGAGTT
GATAATCACATTTCAATTGGTGTTTACTATCTTTGCCAG
CTGTGATTCCAAACGGACTGA
TGTCACTGGCTCAATAGCTTTAGCAATTGGATTTTCTGTTGCAATTGGACATTTATTTG
CA
GTAAGTTTCCAAGTCCATTTAAATAATCAATCCCACCTCATTTATCCTCACTCTAGCTGGCCTGAAGATGTTGTGTTT
TACAGCAGTAGCTCTTTAGTATCCAGCCATGACTGTCCATTTTAGGTTATAATTTTTCCAACTGCTCAATGAGAATGTTG
ATATAGCTGCTAATATCTTGAGGTTCCTCTAAGTGACAAATGACAGCAAATTGCAATGAATG
Color Legend: SNP  UTR  CODING
Sample Sets: D76SampleSet
Assays: AQP4-3
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 3: Coding
3139
PDE
1 pub
24441215 GRCh37
22695213 NCBI36
555492
CTGGTCATGGTCTCCTGGTTGAGTT G → A ATAATCACATTTCAATTGGTGTTTA
-164
Leu = Leu
n=
G/G=
G/A=
A/A=
A=
94
43
4
0
0.043
84
38
3
1
0.060
94
47
0
0
0.000
88
42
2
0
0.023
D76SampleSet
Exon 3: Coding
3140
PDE
2 pubs
24441155 GRCh37
22695153 NCBI36
615552
CCAGCTGTGATTCCAAACGGACTGA T → A GTCACTGGCTCAATAGCTTTAGCAA
-184
Asp → Glu
(D=45)
n=
T/T=
T/A=
A/A=
A=
94
45
2
0
0.021
84
42
0
0
0.000
94
47
0
0
0.000
88
43
1
0
0.011
D76SampleSet

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.