UCSF Pharmacogenetics of Membrane Transporters
Experiment View
NM_001650
NM_004028
XM_005258257
[Your browser is not displaying the SVG image of experimental data in gene context.]
Transcript:NM_001650 [Chr.18(-): 24432007-24445716 GRCh37]
Id:Exon_4
Position:Chr.18(-): 24440611-24441038 GRCh37
Chr.18(-): 22694609-22695036 NCBI36
Sequence:
CTGGCCTGAAGATGTTGTGTTTTACAGCAGTAGCTCTTTAGTATCCAGCCATGACTGTCCATTTTAGGTTATAATTTTTC
CAACTGCTCAATGAGAATGTTGATATAGCTGCTAATATCTTGAGGTTCCTCTAAGTGACAAATGACAGCAAATTGCAATG
AATGATACTTGCTAGTAGCCCTGTTTCAGCAATGTCTGAAGTTGTTTTCTTGTTTCCTATAGATCAATTATACTGGTGCC
AGCATGAATCCCGCCCGATCCTTTGGACCTGCAGTTATCA
TGGGAAATTGGGAAAACCATTGGGTAACCCTCATATTGAT
AGTTCCCATCTTCCTACAGTTGAGGACAATTACCTGTGGGGCTCTTTTATTTTTCATTATTTTGCCTACTACTTTCTCTT
GCATTTCTCCAACCTTGACCCTCACTTT
Color Legend: SNP  UTR  CODING
Sample Sets: D76SampleSet
Assays: AQP4-4
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
3141
PDE
24440884 GRCh37
22694882 NCBI36
  
TCTAAGTGACAAATGACAGCAAATT G → A CAATGAATGATACTTGCTAGTAGCC
- 
 
n=
G/G=
G/A=
A/A=
A=
94
40
7
0
0.074
88
44
0
0
0.000
92
46
0
0
0.000
94
47
0
0
0.000
D76SampleSet
Exon 4: Coding
3142
PDE
1 pub
24440816 GRCh37
22694814 NCBI36
676613
GAAGTTGTTTTCTTGTTTCCTATAG A → C TCAATTATACTGGTGCCAGCATGAA
-205
Ile → Leu
(D=5)
n=
A/A=
A/C=
C/C=
C=
94
46
1
0
0.011
88
44
0
0
0.000
92
46
0
0
0.000
94
45
2
0
0.021
D76SampleSet
Exon 4: Coding
3143
PDE
1 pub
24440758 GRCh37
22694756 NCBI36
734671
CGATCCTTTGGACCTGCAGTTATCA T → C GGGAAATTGGGAAAACCATTGGGTA
-224
Met → Thr
(D=81)
n=
T/T=
T/C=
C/C=
C=
94
47
0
0
0.000
88
43
1
0
0.011
92
46
0
0
0.000
94
46
1
0
0.011
D76SampleSet
Exon 4: Coding
3144
PDE
24440739 GRCh37
22694737 NCBI36
753690
TTATCATGGGAAATTGGGAAAACCA T → C TGGGTAACCCTCATATTGATAGTTC
-230
His = His
n=
T/T=
T/C=
C/C=
C=
94
47
0
0
0.000
88
43
1
0
0.011
92
46
0
0
0.000
94
47
0
0
0.000
D76SampleSet

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.